FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631725_at:

>probe:Drosophila_2:1631725_at:471:145; Interrogation_Position=1050; Antisense; ACTAAATTAATGTCGCGAGGCCTAT
>probe:Drosophila_2:1631725_at:58:421; Interrogation_Position=1103; Antisense; GAGCATATGACAATTCTATCCCAAC
>probe:Drosophila_2:1631725_at:686:191; Interrogation_Position=1125; Antisense; AACTATGTGTTGTGTCATGCTCGTA
>probe:Drosophila_2:1631725_at:162:567; Interrogation_Position=586; Antisense; GGCAAACGAAAGTATCCGCGCACCT
>probe:Drosophila_2:1631725_at:169:355; Interrogation_Position=605; Antisense; GCACCTGGTTCGAATGTGTGGTCAA
>probe:Drosophila_2:1631725_at:454:283; Interrogation_Position=708; Antisense; CTGCCCCGAGGATTTGTGTGTATTG
>probe:Drosophila_2:1631725_at:369:525; Interrogation_Position=732; Antisense; GGGCAAACTGGAGCTTAACCTCATC
>probe:Drosophila_2:1631725_at:494:657; Interrogation_Position=747; Antisense; TAACCTCATCAAACCCTGCGTTAAG
>probe:Drosophila_2:1631725_at:176:367; Interrogation_Position=772; Antisense; GAATCATCGAAATGTCCGCGCTTCA
>probe:Drosophila_2:1631725_at:54:711; Interrogation_Position=793; Antisense; TTCAGAATGCCCAACTGCTGTGTGG
>probe:Drosophila_2:1631725_at:369:503; Interrogation_Position=845; Antisense; GTCCCTTTAGACGTTGTGGCCAGAG
>probe:Drosophila_2:1631725_at:590:579; Interrogation_Position=862; Antisense; GGCCAGAGACCCAAGACCAAGTATC
>probe:Drosophila_2:1631725_at:652:217; Interrogation_Position=880; Antisense; AAGTATCCAAGTTTCTCCGAGTGTC
>probe:Drosophila_2:1631725_at:373:653; Interrogation_Position=953; Antisense; TCAAGCCGGCCATCTGCGATATGTG

Paste this into a BLAST search page for me
ACTAAATTAATGTCGCGAGGCCTATGAGCATATGACAATTCTATCCCAACAACTATGTGTTGTGTCATGCTCGTAGGCAAACGAAAGTATCCGCGCACCTGCACCTGGTTCGAATGTGTGGTCAACTGCCCCGAGGATTTGTGTGTATTGGGGCAAACTGGAGCTTAACCTCATCTAACCTCATCAAACCCTGCGTTAAGGAATCATCGAAATGTCCGCGCTTCATTCAGAATGCCCAACTGCTGTGTGGGTCCCTTTAGACGTTGTGGCCAGAGGGCCAGAGACCCAAGACCAAGTATCAAGTATCCAAGTTTCTCCGAGTGTCTCAAGCCGGCCATCTGCGATATGTG

Full Affymetrix probeset data:

Annotations for 1631725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720