Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631726_at:

>probe:Drosophila_2:1631726_at:381:619; Interrogation_Position=5915; Antisense; TCGTAGATATGTTCCGACCGGACTC
>probe:Drosophila_2:1631726_at:254:405; Interrogation_Position=5935; Antisense; GACTCCAGCACCGAGTCCAATAATG
>probe:Drosophila_2:1631726_at:448:627; Interrogation_Position=5950; Antisense; TCCAATAATGACCAGGGCTCGCCGG
>probe:Drosophila_2:1631726_at:235:257; Interrogation_Position=6004; Antisense; CACGTCCTAGGGATGGGCATGGCCA
>probe:Drosophila_2:1631726_at:611:159; Interrogation_Position=6099; Antisense; ACAACGCAGCCGGAAGCACGGAAGC
>probe:Drosophila_2:1631726_at:244:151; Interrogation_Position=6129; Antisense; ACAGCAGCCTAGCAACCAAACGTTG
>probe:Drosophila_2:1631726_at:550:197; Interrogation_Position=6147; Antisense; AACGTTGGAGCGAAGAAAGTGCCCT
>probe:Drosophila_2:1631726_at:485:85; Interrogation_Position=6164; Antisense; AGTGCCCTGGTAGTAGCAACAGTTT
>probe:Drosophila_2:1631726_at:591:691; Interrogation_Position=6222; Antisense; TTTGGCAGCCTCTATAGCCGCGATG
>probe:Drosophila_2:1631726_at:242:83; Interrogation_Position=6296; Antisense; CTGGATTCCACGATGGCCGGGAGCC
>probe:Drosophila_2:1631726_at:708:295; Interrogation_Position=6324; Antisense; CGACCACAGCGATTGCGAGCGGGAA
>probe:Drosophila_2:1631726_at:157:77; Interrogation_Position=6425; Antisense; AGGAGTTGACCTCACTGTTGGCAAG
>probe:Drosophila_2:1631726_at:390:259; Interrogation_Position=6437; Antisense; CACTGTTGGCAAGGTATCACGAGAA
>probe:Drosophila_2:1631726_at:490:349; Interrogation_Position=6468; Antisense; GCAGGAGCGCCTAGAATACACGATA

Paste this into a BLAST search page for me
TCGTAGATATGTTCCGACCGGACTCGACTCCAGCACCGAGTCCAATAATGTCCAATAATGACCAGGGCTCGCCGGCACGTCCTAGGGATGGGCATGGCCAACAACGCAGCCGGAAGCACGGAAGCACAGCAGCCTAGCAACCAAACGTTGAACGTTGGAGCGAAGAAAGTGCCCTAGTGCCCTGGTAGTAGCAACAGTTTTTTGGCAGCCTCTATAGCCGCGATGCTGGATTCCACGATGGCCGGGAGCCCGACCACAGCGATTGCGAGCGGGAAAGGAGTTGACCTCACTGTTGGCAAGCACTGTTGGCAAGGTATCACGAGAAGCAGGAGCGCCTAGAATACACGATA

Full Affymetrix probeset data:

Annotations for 1631726_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime