FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631727_at:

>probe:Drosophila_2:1631727_at:248:713; Interrogation_Position=344; Antisense; TTCATCGGAAGAGTCACAAGGGCAT
>probe:Drosophila_2:1631727_at:708:251; Interrogation_Position=360; Antisense; CAAGGGCATGCGCACTATTTCTAAT
>probe:Drosophila_2:1631727_at:531:187; Interrogation_Position=424; Antisense; AACACCGTCTACTATAGCGGCGCTT
>probe:Drosophila_2:1631727_at:38:287; Interrogation_Position=440; Antisense; GCGGCGCTTGGAAAACTAGGTTTAG
>probe:Drosophila_2:1631727_at:32:497; Interrogation_Position=520; Antisense; GTCAGGATGATGTCCCATGTGGGCA
>probe:Drosophila_2:1631727_at:190:543; Interrogation_Position=551; Antisense; GGATTGCTGATCACTCTTATGGACA
>probe:Drosophila_2:1631727_at:252:447; Interrogation_Position=585; Antisense; GATGCCGTTTGATAACTCAGACCTG
>probe:Drosophila_2:1631727_at:59:59; Interrogation_Position=613; Antisense; ATGATAATCGGTCTGCCATTGCATA
>probe:Drosophila_2:1631727_at:564:239; Interrogation_Position=663; Antisense; AATACTTAGAACACTCTCAGAGAGC
>probe:Drosophila_2:1631727_at:718:263; Interrogation_Position=739; Antisense; CAGACGGAACTAGTTGAATCCCTAA
>probe:Drosophila_2:1631727_at:260:595; Interrogation_Position=770; Antisense; TGGGCATACACCTTATCTTCAGCAA
>probe:Drosophila_2:1631727_at:418:645; Interrogation_Position=785; Antisense; TCTTCAGCAATACCTCGGATCTCAG
>probe:Drosophila_2:1631727_at:268:567; Interrogation_Position=811; Antisense; GGCCTTCTGACCAACGGTACAGGTG
>probe:Drosophila_2:1631727_at:75:415; Interrogation_Position=910; Antisense; GACCACGCAGAGTCTATCCAAAGTA

Paste this into a BLAST search page for me
TTCATCGGAAGAGTCACAAGGGCATCAAGGGCATGCGCACTATTTCTAATAACACCGTCTACTATAGCGGCGCTTGCGGCGCTTGGAAAACTAGGTTTAGGTCAGGATGATGTCCCATGTGGGCAGGATTGCTGATCACTCTTATGGACAGATGCCGTTTGATAACTCAGACCTGATGATAATCGGTCTGCCATTGCATAAATACTTAGAACACTCTCAGAGAGCCAGACGGAACTAGTTGAATCCCTAATGGGCATACACCTTATCTTCAGCAATCTTCAGCAATACCTCGGATCTCAGGGCCTTCTGACCAACGGTACAGGTGGACCACGCAGAGTCTATCCAAAGTA

Full Affymetrix probeset data:

Annotations for 1631727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720