Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631729_at:

>probe:Drosophila_2:1631729_at:625:207; Interrogation_Position=2101; Antisense; AAGCATTTCTGCAGGTTTCGGCGCT
>probe:Drosophila_2:1631729_at:727:79; Interrogation_Position=2140; Antisense; AGGTGCACTTTGTACGCTTCGATAG
>probe:Drosophila_2:1631729_at:345:457; Interrogation_Position=2160; Antisense; GATAGCCAGGCTAATGATCTGCCCT
>probe:Drosophila_2:1631729_at:66:591; Interrogation_Position=2251; Antisense; TGGTTTTCCCAACCGATGTGCGGAT
>probe:Drosophila_2:1631729_at:133:139; Interrogation_Position=2287; Antisense; ACGTTTTTGCATTTGTGATCGCCCA
>probe:Drosophila_2:1631729_at:601:605; Interrogation_Position=2302; Antisense; TGATCGCCCAATTGGAGCCGGAGCA
>probe:Drosophila_2:1631729_at:583:113; Interrogation_Position=2323; Antisense; AGCAGCAGGTGCGTTCGGTCTTGAC
>probe:Drosophila_2:1631729_at:198:447; Interrogation_Position=2363; Antisense; GATGCGTAACGTTAGGAGCTGTCTT
>probe:Drosophila_2:1631729_at:260:553; Interrogation_Position=2377; Antisense; GGAGCTGTCTTGACTTTGCCCGCAA
>probe:Drosophila_2:1631729_at:569:487; Interrogation_Position=2406; Antisense; GTACTCCAGCACGTTAACCAATATC
>probe:Drosophila_2:1631729_at:666:363; Interrogation_Position=2451; Antisense; GAACGGGAGCGGGACGACATCCTTT
>probe:Drosophila_2:1631729_at:424:399; Interrogation_Position=2466; Antisense; GACATCCTTTCGCACCTAAGGGAGT
>probe:Drosophila_2:1631729_at:549:473; Interrogation_Position=2489; Antisense; GTTCAACAACTTGCACATGTCCATC
>probe:Drosophila_2:1631729_at:668:215; Interrogation_Position=2566; Antisense; AAGTTACCGTTGATATTTCCTGTAG

Paste this into a BLAST search page for me
AAGCATTTCTGCAGGTTTCGGCGCTAGGTGCACTTTGTACGCTTCGATAGGATAGCCAGGCTAATGATCTGCCCTTGGTTTTCCCAACCGATGTGCGGATACGTTTTTGCATTTGTGATCGCCCATGATCGCCCAATTGGAGCCGGAGCAAGCAGCAGGTGCGTTCGGTCTTGACGATGCGTAACGTTAGGAGCTGTCTTGGAGCTGTCTTGACTTTGCCCGCAAGTACTCCAGCACGTTAACCAATATCGAACGGGAGCGGGACGACATCCTTTGACATCCTTTCGCACCTAAGGGAGTGTTCAACAACTTGCACATGTCCATCAAGTTACCGTTGATATTTCCTGTAG

Full Affymetrix probeset data:

Annotations for 1631729_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime