FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631731_at:

>probe:Drosophila_2:1631731_at:433:15; Interrogation_Position=4137; Antisense; ATTATATTTTGCCTACGCCGTGCTG
>probe:Drosophila_2:1631731_at:360:453; Interrogation_Position=4171; Antisense; GATCTCATCTGTGTGGACGGTGTAC
>probe:Drosophila_2:1631731_at:303:413; Interrogation_Position=4212; Antisense; GACCGGGAAGCGAATCATCCTGATG
>probe:Drosophila_2:1631731_at:258:531; Interrogation_Position=4261; Antisense; GGGTCCAGTTTCTTGTACACTATGC
>probe:Drosophila_2:1631731_at:574:665; Interrogation_Position=4276; Antisense; TACACTATGCTCACAGGTCTGGACG
>probe:Drosophila_2:1631731_at:610:623; Interrogation_Position=4316; Antisense; TGCGCACGCCACTTCTTTTAGAGGG
>probe:Drosophila_2:1631731_at:2:445; Interrogation_Position=4350; Antisense; GATGATTCGGCCCATGGACACAGAG
>probe:Drosophila_2:1631731_at:506:235; Interrogation_Position=4429; Antisense; AATCCTAATGTCAGCATGTCCCGGG
>probe:Drosophila_2:1631731_at:440:217; Interrogation_Position=4498; Antisense; AAGTTCAGTGCCTTCATGGAGATCA
>probe:Drosophila_2:1631731_at:276:65; Interrogation_Position=4564; Antisense; ATGGTATTTGTATTGCCGTTGGGCA
>probe:Drosophila_2:1631731_at:366:355; Interrogation_Position=4586; Antisense; GCACGACCACCTTCTCGGAGATATT
>probe:Drosophila_2:1631731_at:285:551; Interrogation_Position=4602; Antisense; GGAGATATTTCTTACACTGCGCAAA
>probe:Drosophila_2:1631731_at:58:101; Interrogation_Position=4647; Antisense; AGAGGACTACTTTATCACACGCAAC
>probe:Drosophila_2:1631731_at:328:517; Interrogation_Position=4678; Antisense; GTGGGCTTCCAGATATTTACCTATG

Paste this into a BLAST search page for me
ATTATATTTTGCCTACGCCGTGCTGGATCTCATCTGTGTGGACGGTGTACGACCGGGAAGCGAATCATCCTGATGGGGTCCAGTTTCTTGTACACTATGCTACACTATGCTCACAGGTCTGGACGTGCGCACGCCACTTCTTTTAGAGGGGATGATTCGGCCCATGGACACAGAGAATCCTAATGTCAGCATGTCCCGGGAAGTTCAGTGCCTTCATGGAGATCAATGGTATTTGTATTGCCGTTGGGCAGCACGACCACCTTCTCGGAGATATTGGAGATATTTCTTACACTGCGCAAAAGAGGACTACTTTATCACACGCAACGTGGGCTTCCAGATATTTACCTATG

Full Affymetrix probeset data:

Annotations for 1631731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720