FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631733_at:

>probe:Drosophila_2:1631733_at:714:719; Interrogation_Position=118; Antisense; TTGTTCAAGAAGACTGTGCCCGGCC
>probe:Drosophila_2:1631733_at:25:207; Interrogation_Position=157; Antisense; AAGCGGCGCCTGGTGAAACCGGTCA
>probe:Drosophila_2:1631733_at:554:175; Interrogation_Position=172; Antisense; AAACCGGTCAGTCAGCGAGCAATGG
>probe:Drosophila_2:1631733_at:450:419; Interrogation_Position=226; Antisense; GAGCAGGTAATGTTACTCCTCCGAC
>probe:Drosophila_2:1631733_at:719:261; Interrogation_Position=261; Antisense; CACCATGGAGCAGTCATTCGGTCAT
>probe:Drosophila_2:1631733_at:91:647; Interrogation_Position=274; Antisense; TCATTCGGTCATGCCAAGGAGCTGC
>probe:Drosophila_2:1631733_at:630:205; Interrogation_Position=301; Antisense; AAGCGCGAGAAGCTCGTTGCCAGAT
>probe:Drosophila_2:1631733_at:389:399; Interrogation_Position=339; Antisense; GACACTGCGCAAGATGAAGCCACAC
>probe:Drosophila_2:1631733_at:510:53; Interrogation_Position=352; Antisense; ATGAAGCCACACGTTACCATCGAGG
>probe:Drosophila_2:1631733_at:477:637; Interrogation_Position=371; Antisense; TCGAGGAGCGGCTGAACCAGCTGAA
>probe:Drosophila_2:1631733_at:514:647; Interrogation_Position=398; Antisense; TCAAGGAGGCCTGGGACTAGCCGTC
>probe:Drosophila_2:1631733_at:504:349; Interrogation_Position=426; Antisense; GCAGCTGCTAAACCGGCGTTATTTG
>probe:Drosophila_2:1631733_at:432:475; Interrogation_Position=70; Antisense; GTTTTTACTTGGCACTTGAGCAACA
>probe:Drosophila_2:1631733_at:692:53; Interrogation_Position=97; Antisense; ATGCACCTGACGCTGATCAATTTGT

Paste this into a BLAST search page for me
TTGTTCAAGAAGACTGTGCCCGGCCAAGCGGCGCCTGGTGAAACCGGTCAAAACCGGTCAGTCAGCGAGCAATGGGAGCAGGTAATGTTACTCCTCCGACCACCATGGAGCAGTCATTCGGTCATTCATTCGGTCATGCCAAGGAGCTGCAAGCGCGAGAAGCTCGTTGCCAGATGACACTGCGCAAGATGAAGCCACACATGAAGCCACACGTTACCATCGAGGTCGAGGAGCGGCTGAACCAGCTGAATCAAGGAGGCCTGGGACTAGCCGTCGCAGCTGCTAAACCGGCGTTATTTGGTTTTTACTTGGCACTTGAGCAACAATGCACCTGACGCTGATCAATTTGT

Full Affymetrix probeset data:

Annotations for 1631733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720