Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631735_at:

>probe:Drosophila_2:1631735_at:603:645; Interrogation_Position=2370; Antisense; TCTTAAACTGCTCAATCCCCAGAAT
>probe:Drosophila_2:1631735_at:119:111; Interrogation_Position=2390; Antisense; AGAATCCCATCTTTCAGTTCATACG
>probe:Drosophila_2:1631735_at:194:135; Interrogation_Position=2412; Antisense; ACGCCCTTCTGCCAAACTAAAGATG
>probe:Drosophila_2:1631735_at:654:677; Interrogation_Position=2450; Antisense; TAGAGGAACTGCTCACAGGCACCAA
>probe:Drosophila_2:1631735_at:343:39; Interrogation_Position=2493; Antisense; ATCTCAGTGGGTAAGCTATCTCGCA
>probe:Drosophila_2:1631735_at:453:339; Interrogation_Position=2507; Antisense; GCTATCTCGCAATCGTCCGTAAAAG
>probe:Drosophila_2:1631735_at:530:187; Interrogation_Position=2553; Antisense; AACACTTGACTTTAATGGCCAGCTG
>probe:Drosophila_2:1631735_at:601:325; Interrogation_Position=2591; Antisense; GCGAGATTGTACTGCGAGACTTTAA
>probe:Drosophila_2:1631735_at:720:197; Interrogation_Position=2623; Antisense; AACGAGAAGCGCGTTCTTCTACTCT
>probe:Drosophila_2:1631735_at:182:383; Interrogation_Position=2679; Antisense; GAACGTGGCCAATCATATGCTAATT
>probe:Drosophila_2:1631735_at:229:571; Interrogation_Position=2739; Antisense; GGCTCAGGACCGCATTTATCGATAT
>probe:Drosophila_2:1631735_at:217:37; Interrogation_Position=2785; Antisense; ATCTACCGCTACATGTGCCAGGACA
>probe:Drosophila_2:1631735_at:167:297; Interrogation_Position=2821; Antisense; CGAATTAAGTCCCTGCAAGATTGCA
>probe:Drosophila_2:1631735_at:668:589; Interrogation_Position=2910; Antisense; TGGTCTCAACCTCGCGGAGCTAAAG

Paste this into a BLAST search page for me
TCTTAAACTGCTCAATCCCCAGAATAGAATCCCATCTTTCAGTTCATACGACGCCCTTCTGCCAAACTAAAGATGTAGAGGAACTGCTCACAGGCACCAAATCTCAGTGGGTAAGCTATCTCGCAGCTATCTCGCAATCGTCCGTAAAAGAACACTTGACTTTAATGGCCAGCTGGCGAGATTGTACTGCGAGACTTTAAAACGAGAAGCGCGTTCTTCTACTCTGAACGTGGCCAATCATATGCTAATTGGCTCAGGACCGCATTTATCGATATATCTACCGCTACATGTGCCAGGACACGAATTAAGTCCCTGCAAGATTGCATGGTCTCAACCTCGCGGAGCTAAAG

Full Affymetrix probeset data:

Annotations for 1631735_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime