FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631738_at:

>probe:Drosophila_2:1631738_at:406:209; Interrogation_Position=1958; Antisense; AAGCACGCTTGGCAAATGGGTTGAC
>probe:Drosophila_2:1631738_at:91:235; Interrogation_Position=2000; Antisense; AATCGCACTCTTCGGTCGACATGAA
>probe:Drosophila_2:1631738_at:456:399; Interrogation_Position=2017; Antisense; GACATGAATCATGTGCCACTGCCGA
>probe:Drosophila_2:1631738_at:424:625; Interrogation_Position=2036; Antisense; TGCCGACTGGCGTCAATGCGGTCAA
>probe:Drosophila_2:1631738_at:407:43; Interrogation_Position=2113; Antisense; ATCGAAGGCTATGCGTCAACTCAAC
>probe:Drosophila_2:1631738_at:542:293; Interrogation_Position=2172; Antisense; CGAGGATGAGTTTCGCCCGCGACTG
>probe:Drosophila_2:1631738_at:226:321; Interrogation_Position=2186; Antisense; GCCCGCGACTGGAGCATAACTATTC
>probe:Drosophila_2:1631738_at:234:717; Interrogation_Position=2214; Antisense; TTCGGACTCCAACATAACTCTGCAA
>probe:Drosophila_2:1631738_at:58:325; Interrogation_Position=2244; Antisense; GCGCAGCTGAGCTAATGCACCCAAA
>probe:Drosophila_2:1631738_at:39:457; Interrogation_Position=2305; Antisense; GATAGCATTGTTTAGCGGCTCCTCC
>probe:Drosophila_2:1631738_at:713:281; Interrogation_Position=2326; Antisense; CTCCTCAGCGGGTTTCTTGGTATTG
>probe:Drosophila_2:1631738_at:306:481; Interrogation_Position=2345; Antisense; GTATTGGCCGCGTATTGTATACTTT
>probe:Drosophila_2:1631738_at:230:509; Interrogation_Position=2400; Antisense; GTGAACGGTAGTCCATTGCGATAAT
>probe:Drosophila_2:1631738_at:367:91; Interrogation_Position=2443; Antisense; AGATCTCTGTGTAAATTCCCTTTTA

Paste this into a BLAST search page for me
AAGCACGCTTGGCAAATGGGTTGACAATCGCACTCTTCGGTCGACATGAAGACATGAATCATGTGCCACTGCCGATGCCGACTGGCGTCAATGCGGTCAAATCGAAGGCTATGCGTCAACTCAACCGAGGATGAGTTTCGCCCGCGACTGGCCCGCGACTGGAGCATAACTATTCTTCGGACTCCAACATAACTCTGCAAGCGCAGCTGAGCTAATGCACCCAAAGATAGCATTGTTTAGCGGCTCCTCCCTCCTCAGCGGGTTTCTTGGTATTGGTATTGGCCGCGTATTGTATACTTTGTGAACGGTAGTCCATTGCGATAATAGATCTCTGTGTAAATTCCCTTTTA

Full Affymetrix probeset data:

Annotations for 1631738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720