Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631739_at:

>probe:Drosophila_2:1631739_at:718:325; Interrogation_Position=167; Antisense; GCGAGGAGCTGAACCTCTCGGGACA
>probe:Drosophila_2:1631739_at:149:641; Interrogation_Position=182; Antisense; TCTCGGGACACTTCTACAGGAACAA
>probe:Drosophila_2:1631739_at:614:185; Interrogation_Position=202; Antisense; AACAAGATCAAGTTCCTGGCCTACC
>probe:Drosophila_2:1631739_at:455:359; Interrogation_Position=230; Antisense; GCAAGCGGTGCAACGTGAACCCAGC
>probe:Drosophila_2:1631739_at:325:345; Interrogation_Position=287; Antisense; GCATCTTCTACAAGGCAGTCCGAGG
>probe:Drosophila_2:1631739_at:352:439; Interrogation_Position=308; Antisense; GAGGCATGATCCCACACAAGACCAA
>probe:Drosophila_2:1631739_at:706:643; Interrogation_Position=357; Antisense; TCTACGTGTGTTCGACGGCATCCCA
>probe:Drosophila_2:1631739_at:194:507; Interrogation_Position=412; Antisense; GTGCCCATCGCTATGCGTGTGCTGA
>probe:Drosophila_2:1631739_at:166:357; Interrogation_Position=452; Antisense; GCAAGTACTGCCAGGTGGGTCGCCT
>probe:Drosophila_2:1631739_at:684:597; Interrogation_Position=476; Antisense; TGTCGCACGAGGTCGGCTGGCACTA
>probe:Drosophila_2:1631739_at:113:653; Interrogation_Position=512; Antisense; TCAAGAGCCTGGAGCGCAAGCGCAA
>probe:Drosophila_2:1631739_at:239:205; Interrogation_Position=529; Antisense; AAGCGCAAGGCCAAGCTCCGTGTCA
>probe:Drosophila_2:1631739_at:155:319; Interrogation_Position=619; Antisense; GCCGAGCCCTTCAACAAAATCATCA
>probe:Drosophila_2:1631739_at:718:237; Interrogation_Position=636; Antisense; AATCATCAAATCCTACGGCTACGAG

Paste this into a BLAST search page for me
GCGAGGAGCTGAACCTCTCGGGACATCTCGGGACACTTCTACAGGAACAAAACAAGATCAAGTTCCTGGCCTACCGCAAGCGGTGCAACGTGAACCCAGCGCATCTTCTACAAGGCAGTCCGAGGGAGGCATGATCCCACACAAGACCAATCTACGTGTGTTCGACGGCATCCCAGTGCCCATCGCTATGCGTGTGCTGAGCAAGTACTGCCAGGTGGGTCGCCTTGTCGCACGAGGTCGGCTGGCACTATCAAGAGCCTGGAGCGCAAGCGCAAAAGCGCAAGGCCAAGCTCCGTGTCAGCCGAGCCCTTCAACAAAATCATCAAATCATCAAATCCTACGGCTACGAG

Full Affymetrix probeset data:

Annotations for 1631739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime