FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631740_at:

>probe:Drosophila_2:1631740_at:62:27; Interrogation_Position=173; Antisense; ATAGAGGCAACTTTGGATTCCAACA
>probe:Drosophila_2:1631740_at:391:375; Interrogation_Position=203; Antisense; GAAGATCTACGAATTCCGAAGCATA
>probe:Drosophila_2:1631740_at:304:641; Interrogation_Position=377; Antisense; TCTGGCAATGCCTACGATCTTAAAA
>probe:Drosophila_2:1631740_at:451:591; Interrogation_Position=428; Antisense; TGTGGTTACGGAAACGCCATAAACT
>probe:Drosophila_2:1631740_at:64:533; Interrogation_Position=466; Antisense; GGTGGACAAACTACAGGATCTGGCT
>probe:Drosophila_2:1631740_at:567:639; Interrogation_Position=484; Antisense; TCTGGCTAAATCGATCCCAACGGAT
>probe:Drosophila_2:1631740_at:500:195; Interrogation_Position=502; Antisense; AACGGATCCCGATACAGTCTACCTG
>probe:Drosophila_2:1631740_at:180:155; Interrogation_Position=515; Antisense; ACAGTCTACCTGACCTGTCAATGTG
>probe:Drosophila_2:1631740_at:72:439; Interrogation_Position=558; Antisense; GAGGCACAGAAGCTCCGACTCAAAG
>probe:Drosophila_2:1631740_at:160:475; Interrogation_Position=593; Antisense; GTTAATTTCGAAGAGCTGTCCAGCT
>probe:Drosophila_2:1631740_at:182:103; Interrogation_Position=604; Antisense; AGAGCTGTCCAGCTACTTCGAAAAT
>probe:Drosophila_2:1631740_at:183:339; Interrogation_Position=631; Antisense; GCTCAACATACCCAAGAATCTTCCG
>probe:Drosophila_2:1631740_at:322:367; Interrogation_Position=646; Antisense; GAATCTTCCGCTCAGCGCTGAAATA
>probe:Drosophila_2:1631740_at:169:387; Interrogation_Position=95; Antisense; GAAAAAATCTCCTCCGAGCTGCGTA

Paste this into a BLAST search page for me
ATAGAGGCAACTTTGGATTCCAACAGAAGATCTACGAATTCCGAAGCATATCTGGCAATGCCTACGATCTTAAAATGTGGTTACGGAAACGCCATAAACTGGTGGACAAACTACAGGATCTGGCTTCTGGCTAAATCGATCCCAACGGATAACGGATCCCGATACAGTCTACCTGACAGTCTACCTGACCTGTCAATGTGGAGGCACAGAAGCTCCGACTCAAAGGTTAATTTCGAAGAGCTGTCCAGCTAGAGCTGTCCAGCTACTTCGAAAATGCTCAACATACCCAAGAATCTTCCGGAATCTTCCGCTCAGCGCTGAAATAGAAAAAATCTCCTCCGAGCTGCGTA

Full Affymetrix probeset data:

Annotations for 1631740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720