Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631744_at:

>probe:Drosophila_2:1631744_at:205:415; Interrogation_Position=1122; Antisense; GACCAGATCCTCGAACAACATGTCG
>probe:Drosophila_2:1631744_at:73:61; Interrogation_Position=1141; Antisense; ATGTCGCCCAGAACCTGTTCGGGTG
>probe:Drosophila_2:1631744_at:255:603; Interrogation_Position=1156; Antisense; TGTTCGGGTGCCTACAGTAATGCCA
>probe:Drosophila_2:1631744_at:575:49; Interrogation_Position=1175; Antisense; ATGCCACGCTGGAGGATTGCCTCAA
>probe:Drosophila_2:1631744_at:138:465; Interrogation_Position=1189; Antisense; GATTGCCTCAATGACGACATGCTGA
>probe:Drosophila_2:1631744_at:451:397; Interrogation_Position=1204; Antisense; GACATGCTGACCACGTTGACGGTGC
>probe:Drosophila_2:1631744_at:259:387; Interrogation_Position=1236; Antisense; GAACAAGCGGCTCCATGGTTGCCCA
>probe:Drosophila_2:1631744_at:121:109; Interrogation_Position=1286; Antisense; AGAAGCGACGCACCCTGAAGAATCG
>probe:Drosophila_2:1631744_at:148:211; Interrogation_Position=1303; Antisense; AAGAATCGCGGCTATGCCCAGAACT
>probe:Drosophila_2:1631744_at:9:631; Interrogation_Position=1343; Antisense; TCCATCAGCGCCACGAACTGGAGAA
>probe:Drosophila_2:1631744_at:93:285; Interrogation_Position=1402; Antisense; CTGAAGCTGGAGTACTCGAGGGTCT
>probe:Drosophila_2:1631744_at:652:121; Interrogation_Position=1433; Antisense; AGCGGGATGCCCTCATGCAGCGTCT
>probe:Drosophila_2:1631744_at:152:333; Interrogation_Position=1505; Antisense; GCGGCGATAGCCAAAGCTCTCCGGA
>probe:Drosophila_2:1631744_at:638:207; Interrogation_Position=1518; Antisense; AAGCTCTCCGGAATTCTACCTCTGA

Paste this into a BLAST search page for me
GACCAGATCCTCGAACAACATGTCGATGTCGCCCAGAACCTGTTCGGGTGTGTTCGGGTGCCTACAGTAATGCCAATGCCACGCTGGAGGATTGCCTCAAGATTGCCTCAATGACGACATGCTGAGACATGCTGACCACGTTGACGGTGCGAACAAGCGGCTCCATGGTTGCCCAAGAAGCGACGCACCCTGAAGAATCGAAGAATCGCGGCTATGCCCAGAACTTCCATCAGCGCCACGAACTGGAGAACTGAAGCTGGAGTACTCGAGGGTCTAGCGGGATGCCCTCATGCAGCGTCTGCGGCGATAGCCAAAGCTCTCCGGAAAGCTCTCCGGAATTCTACCTCTGA

Full Affymetrix probeset data:

Annotations for 1631744_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime