Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631745_at:

>probe:Drosophila_2:1631745_at:231:137; Interrogation_Position=1356; Antisense; ACGACATCCATCTGGCACCATTATG
>probe:Drosophila_2:1631745_at:665:329; Interrogation_Position=1381; Antisense; GCAAGGGAACCCACTGCGAACAGAT
>probe:Drosophila_2:1631745_at:668:385; Interrogation_Position=1398; Antisense; GAACAGATTGGAGTGCCCCGCGAAG
>probe:Drosophila_2:1631745_at:104:619; Interrogation_Position=1411; Antisense; TGCCCCGCGAAGTGGACGTGAAGTT
>probe:Drosophila_2:1631745_at:214:509; Interrogation_Position=1428; Antisense; GTGAAGTTAACCTGCACACCTGTAA
>probe:Drosophila_2:1631745_at:661:683; Interrogation_Position=1471; Antisense; TATCCATGTACCTGCTTGAGCCGAA
>probe:Drosophila_2:1631745_at:728:607; Interrogation_Position=1487; Antisense; TGAGCCGAAGACGTGCCAGTATATC
>probe:Drosophila_2:1631745_at:622:91; Interrogation_Position=1504; Antisense; AGTATATCCTGGTCGTGGAGTCGCC
>probe:Drosophila_2:1631745_at:124:551; Interrogation_Position=1520; Antisense; GGAGTCGCCCACAATATGTGATCTC
>probe:Drosophila_2:1631745_at:39:375; Interrogation_Position=1557; Antisense; GATTCCCAGGGCCTAGTTAAACTGG
>probe:Drosophila_2:1631745_at:273:131; Interrogation_Position=1611; Antisense; ACCGATAAGTCGACTACCAGTTCCG
>probe:Drosophila_2:1631745_at:473:551; Interrogation_Position=1676; Antisense; GGAGAATCACCCATAGGCTGTCCGT
>probe:Drosophila_2:1631745_at:721:571; Interrogation_Position=1691; Antisense; GGCTGTCCGTGTATTCTAGTGAATT
>probe:Drosophila_2:1631745_at:595:211; Interrogation_Position=1795; Antisense; AAGAACTCTGTTTCGGTCTGATAGA

Paste this into a BLAST search page for me
ACGACATCCATCTGGCACCATTATGGCAAGGGAACCCACTGCGAACAGATGAACAGATTGGAGTGCCCCGCGAAGTGCCCCGCGAAGTGGACGTGAAGTTGTGAAGTTAACCTGCACACCTGTAATATCCATGTACCTGCTTGAGCCGAATGAGCCGAAGACGTGCCAGTATATCAGTATATCCTGGTCGTGGAGTCGCCGGAGTCGCCCACAATATGTGATCTCGATTCCCAGGGCCTAGTTAAACTGGACCGATAAGTCGACTACCAGTTCCGGGAGAATCACCCATAGGCTGTCCGTGGCTGTCCGTGTATTCTAGTGAATTAAGAACTCTGTTTCGGTCTGATAGA

Full Affymetrix probeset data:

Annotations for 1631745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime