Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631749_at:

>probe:Drosophila_2:1631749_at:324:543; Interrogation_Position=255; Antisense; GGATAGCTACCTTGTGTACTTGAAC
>probe:Drosophila_2:1631749_at:709:111; Interrogation_Position=280; Antisense; AGCACACTGTTTTTCATATACCTGA
>probe:Drosophila_2:1631749_at:220:375; Interrogation_Position=316; Antisense; GAAGATGCCTCAAATCATGCTGTGA
>probe:Drosophila_2:1631749_at:575:269; Interrogation_Position=331; Antisense; CATGCTGTGATGCACGATTTGCGTC
>probe:Drosophila_2:1631749_at:477:459; Interrogation_Position=346; Antisense; GATTTGCGTCGTACAAGGGACCTAC
>probe:Drosophila_2:1631749_at:568:79; Interrogation_Position=361; Antisense; AGGGACCTACTTGCCCGCGATAAGA
>probe:Drosophila_2:1631749_at:264:31; Interrogation_Position=388; Antisense; ATAAACGATGCTCTAGCGGCGCCAA
>probe:Drosophila_2:1631749_at:506:211; Interrogation_Position=411; Antisense; AAGACTGGATATGCCCGCTGCCAAG
>probe:Drosophila_2:1631749_at:471:323; Interrogation_Position=435; Antisense; GCGATTTATCGCAGCTGGAACCCAC
>probe:Drosophila_2:1631749_at:713:119; Interrogation_Position=447; Antisense; AGCTGGAACCCACACACGATTTGTG
>probe:Drosophila_2:1631749_at:487:545; Interrogation_Position=581; Antisense; GGATCATTTGCCTTTGTTTCGTCGT
>probe:Drosophila_2:1631749_at:727:477; Interrogation_Position=596; Antisense; GTTTCGTCGTTACGCTAGACAATGA
>probe:Drosophila_2:1631749_at:234:459; Interrogation_Position=651; Antisense; GATATTTTCTTACTGAACCATCCAA
>probe:Drosophila_2:1631749_at:292:327; Interrogation_Position=683; Antisense; GCGTCACAAGCAATCGACTCATCAA

Paste this into a BLAST search page for me
GGATAGCTACCTTGTGTACTTGAACAGCACACTGTTTTTCATATACCTGAGAAGATGCCTCAAATCATGCTGTGACATGCTGTGATGCACGATTTGCGTCGATTTGCGTCGTACAAGGGACCTACAGGGACCTACTTGCCCGCGATAAGAATAAACGATGCTCTAGCGGCGCCAAAAGACTGGATATGCCCGCTGCCAAGGCGATTTATCGCAGCTGGAACCCACAGCTGGAACCCACACACGATTTGTGGGATCATTTGCCTTTGTTTCGTCGTGTTTCGTCGTTACGCTAGACAATGAGATATTTTCTTACTGAACCATCCAAGCGTCACAAGCAATCGACTCATCAA

Full Affymetrix probeset data:

Annotations for 1631749_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime