Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631750_a_at:

>probe:Drosophila_2:1631750_a_at:503:585; Interrogation_Position=255; Antisense; TGGAGAAGGATCTGACGGCCCTGCA
>probe:Drosophila_2:1631750_a_at:685:69; Interrogation_Position=279; Antisense; AGGCCACCATCCGTAGCGACAAGAA
>probe:Drosophila_2:1631750_a_at:304:653; Interrogation_Position=402; Antisense; TCAATCTGTTGGGTCTGCTGGCTGA
>probe:Drosophila_2:1631750_a_at:594:617; Interrogation_Position=417; Antisense; TGCTGGCTGACAACGGACGTCTAAA
>probe:Drosophila_2:1631750_a_at:110:587; Interrogation_Position=447; Antisense; TGGACACCGTGATCAATGCCTACAA
>probe:Drosophila_2:1631750_a_at:635:725; Interrogation_Position=530; Antisense; TTGGATGCGTCCCAGAGCAAGCAGC
>probe:Drosophila_2:1631750_a_at:397:531; Interrogation_Position=559; Antisense; GGGTGCCCTTAAGTCTTTCCTGAAG
>probe:Drosophila_2:1631750_a_at:70:721; Interrogation_Position=575; Antisense; TTCCTGAAGGGCAACGAGTCTCTGA
>probe:Drosophila_2:1631750_a_at:610:411; Interrogation_Position=617; Antisense; GACCCCAGCATCATTGGTGGCCTGA
>probe:Drosophila_2:1631750_a_at:312:317; Interrogation_Position=636; Antisense; GCCTGATCGTTTCCATTGGCGACAA
>probe:Drosophila_2:1631750_a_at:338:489; Interrogation_Position=661; Antisense; GTACGTCGACATGAGCATTGCCACT
>probe:Drosophila_2:1631750_a_at:114:223; Interrogation_Position=686; Antisense; AAGGTCAAGCTCTACACCGATGTCA
>probe:Drosophila_2:1631750_a_at:273:103; Interrogation_Position=714; Antisense; AGACCGCTGCCTAGACTCTTAAGGA
>probe:Drosophila_2:1631750_a_at:116:361; Interrogation_Position=800; Antisense; GAATAAAACACTCTTCACCCTTTGA

Paste this into a BLAST search page for me
TGGAGAAGGATCTGACGGCCCTGCAAGGCCACCATCCGTAGCGACAAGAATCAATCTGTTGGGTCTGCTGGCTGATGCTGGCTGACAACGGACGTCTAAATGGACACCGTGATCAATGCCTACAATTGGATGCGTCCCAGAGCAAGCAGCGGGTGCCCTTAAGTCTTTCCTGAAGTTCCTGAAGGGCAACGAGTCTCTGAGACCCCAGCATCATTGGTGGCCTGAGCCTGATCGTTTCCATTGGCGACAAGTACGTCGACATGAGCATTGCCACTAAGGTCAAGCTCTACACCGATGTCAAGACCGCTGCCTAGACTCTTAAGGAGAATAAAACACTCTTCACCCTTTGA

Full Affymetrix probeset data:

Annotations for 1631750_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime