FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631751_at:

>probe:Drosophila_2:1631751_at:501:103; Interrogation_Position=107; Antisense; AGACCACCATGGAGTACACCTTGAC
>probe:Drosophila_2:1631751_at:274:431; Interrogation_Position=118; Antisense; GAGTACACCTTGACCGTGCATTACG
>probe:Drosophila_2:1631751_at:289:315; Interrogation_Position=145; Antisense; GCCTTGATCAGCACCTTAACTTATA
>probe:Drosophila_2:1631751_at:466:655; Interrogation_Position=168; Antisense; TAAGGCGGCCAAAATGATTACCAAT
>probe:Drosophila_2:1631751_at:9:15; Interrogation_Position=184; Antisense; ATTACCAATTTGGATGCCAGCAATG
>probe:Drosophila_2:1631751_at:138:121; Interrogation_Position=209; Antisense; AGCTGGTGACAATACGTCTGCGCAC
>probe:Drosophila_2:1631751_at:102:499; Interrogation_Position=224; Antisense; GTCTGCGCACCAAGGTTCACGAGGT
>probe:Drosophila_2:1631751_at:193:473; Interrogation_Position=238; Antisense; GTTCACGAGGTGATTGTGCTGCCCT
>probe:Drosophila_2:1631751_at:432:625; Interrogation_Position=257; Antisense; TGCCCTCCGAGAACTACATCATTAT
>probe:Drosophila_2:1631751_at:606:727; Interrogation_Position=281; Antisense; TTGTAGTGCAAAATCCAGGCACCTA
>probe:Drosophila_2:1631751_at:599:389; Interrogation_Position=39; Antisense; GAAACGCTATCAAAACTACCCCAAT
>probe:Drosophila_2:1631751_at:621:189; Interrogation_Position=52; Antisense; AACTACCCCAATGTTTCTGGCATAA
>probe:Drosophila_2:1631751_at:7:567; Interrogation_Position=70; Antisense; GGCATAATTATTTTGGACCCGTTCG
>probe:Drosophila_2:1631751_at:398:411; Interrogation_Position=85; Antisense; GACCCGTTCGCTATACCAATCAAGA

Paste this into a BLAST search page for me
AGACCACCATGGAGTACACCTTGACGAGTACACCTTGACCGTGCATTACGGCCTTGATCAGCACCTTAACTTATATAAGGCGGCCAAAATGATTACCAATATTACCAATTTGGATGCCAGCAATGAGCTGGTGACAATACGTCTGCGCACGTCTGCGCACCAAGGTTCACGAGGTGTTCACGAGGTGATTGTGCTGCCCTTGCCCTCCGAGAACTACATCATTATTTGTAGTGCAAAATCCAGGCACCTAGAAACGCTATCAAAACTACCCCAATAACTACCCCAATGTTTCTGGCATAAGGCATAATTATTTTGGACCCGTTCGGACCCGTTCGCTATACCAATCAAGA

Full Affymetrix probeset data:

Annotations for 1631751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720