FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631753_at:

>probe:Drosophila_2:1631753_at:268:367; Interrogation_Position=115; Antisense; GAATCCATACCCACCAAAGTGCTGA
>probe:Drosophila_2:1631753_at:114:221; Interrogation_Position=131; Antisense; AAGTGCTGATCATCTCCAGCGTAGT
>probe:Drosophila_2:1631753_at:227:261; Interrogation_Position=147; Antisense; CAGCGTAGTCCTGATCACTTGTATT
>probe:Drosophila_2:1631753_at:161:151; Interrogation_Position=163; Antisense; ACTTGTATTTGGATAGGCTGCGCCT
>probe:Drosophila_2:1631753_at:269:535; Interrogation_Position=216; Antisense; GGTCCAGTATCTTCAGAGCCAACTT
>probe:Drosophila_2:1631753_at:87:97; Interrogation_Position=23; Antisense; AGATCGCCGTAAAGTGGTTCCCTAT
>probe:Drosophila_2:1631753_at:101:255; Interrogation_Position=235; Antisense; CAACTTGACGAACTGTGGCTGCTGC
>probe:Drosophila_2:1631753_at:33:167; Interrogation_Position=300; Antisense; AAATGCCCGGGAGCAGAATCCGCCG
>probe:Drosophila_2:1631753_at:421:235; Interrogation_Position=316; Antisense; AATCCGCCGGAGTATATTCCGCCTA
>probe:Drosophila_2:1631753_at:171:691; Interrogation_Position=330; Antisense; TATTCCGCCTATGGATCCCCAGGAG
>probe:Drosophila_2:1631753_at:408:541; Interrogation_Position=38; Antisense; GGTTCCCTATTTCGCTGGTGCAGGA
>probe:Drosophila_2:1631753_at:511:509; Interrogation_Position=55; Antisense; GTGCAGGAAGTACTGGCAGCTCAAC
>probe:Drosophila_2:1631753_at:729:117; Interrogation_Position=72; Antisense; AGCTCAACAGCCAGCGATATCCGAA
>probe:Drosophila_2:1631753_at:422:41; Interrogation_Position=96; Antisense; ATCGTGGAGCTTTTCACTGGAATCC

Paste this into a BLAST search page for me
GAATCCATACCCACCAAAGTGCTGAAAGTGCTGATCATCTCCAGCGTAGTCAGCGTAGTCCTGATCACTTGTATTACTTGTATTTGGATAGGCTGCGCCTGGTCCAGTATCTTCAGAGCCAACTTAGATCGCCGTAAAGTGGTTCCCTATCAACTTGACGAACTGTGGCTGCTGCAAATGCCCGGGAGCAGAATCCGCCGAATCCGCCGGAGTATATTCCGCCTATATTCCGCCTATGGATCCCCAGGAGGGTTCCCTATTTCGCTGGTGCAGGAGTGCAGGAAGTACTGGCAGCTCAACAGCTCAACAGCCAGCGATATCCGAAATCGTGGAGCTTTTCACTGGAATCC

Full Affymetrix probeset data:

Annotations for 1631753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720