FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631755_at:

>probe:Drosophila_2:1631755_at:471:167; Interrogation_Position=1025; Antisense; AAATGTCCCGGATTACAGCCAGAAA
>probe:Drosophila_2:1631755_at:601:163; Interrogation_Position=1047; Antisense; AAATATTCTTGCTGCCTTAGCTGGC
>probe:Drosophila_2:1631755_at:54:601; Interrogation_Position=1097; Antisense; TGTAAGCCGTGTAATCTCAGCGTAC
>probe:Drosophila_2:1631755_at:609:389; Interrogation_Position=1230; Antisense; GAAACACTTGTATTACGCCGATGAC
>probe:Drosophila_2:1631755_at:729:133; Interrogation_Position=1244; Antisense; ACGCCGATGACAGTGCTCGCAATGA
>probe:Drosophila_2:1631755_at:484:143; Interrogation_Position=1269; Antisense; ACTGATCCGTAAATGGTCGTGGCCA
>probe:Drosophila_2:1631755_at:145:537; Interrogation_Position=1283; Antisense; GGTCGTGGCCACTCAGAATCGAAAT
>probe:Drosophila_2:1631755_at:410:531; Interrogation_Position=1326; Antisense; GGGTATACTCCCAATCTTTTGATCA
>probe:Drosophila_2:1631755_at:89:591; Interrogation_Position=1404; Antisense; TGGTTTTATGTATTATCGCCTAGAA
>probe:Drosophila_2:1631755_at:627:245; Interrogation_Position=900; Antisense; AATTCTAGCAGCTGGTCTGGATGTA
>probe:Drosophila_2:1631755_at:409:589; Interrogation_Position=917; Antisense; TGGATGTAACGACGCCGGAGCCATT
>probe:Drosophila_2:1631755_at:305:235; Interrogation_Position=945; Antisense; AATCGACGATCCTCTTCTGAAACTG
>probe:Drosophila_2:1631755_at:357:143; Interrogation_Position=966; Antisense; ACTGGATAATGTGGTTATTCTCCCC
>probe:Drosophila_2:1631755_at:147:151; Interrogation_Position=992; Antisense; ACATTGGCAGCGCTGACATCGAAAC

Paste this into a BLAST search page for me
AAATGTCCCGGATTACAGCCAGAAAAAATATTCTTGCTGCCTTAGCTGGCTGTAAGCCGTGTAATCTCAGCGTACGAAACACTTGTATTACGCCGATGACACGCCGATGACAGTGCTCGCAATGAACTGATCCGTAAATGGTCGTGGCCAGGTCGTGGCCACTCAGAATCGAAATGGGTATACTCCCAATCTTTTGATCATGGTTTTATGTATTATCGCCTAGAAAATTCTAGCAGCTGGTCTGGATGTATGGATGTAACGACGCCGGAGCCATTAATCGACGATCCTCTTCTGAAACTGACTGGATAATGTGGTTATTCTCCCCACATTGGCAGCGCTGACATCGAAAC

Full Affymetrix probeset data:

Annotations for 1631755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720