Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631756_at:

>probe:Drosophila_2:1631756_at:345:443; Interrogation_Position=1626; Antisense; GATGTCTCACAAACGACCGATTCTC
>probe:Drosophila_2:1631756_at:349:413; Interrogation_Position=1640; Antisense; GACCGATTCTCACCATCAAATACAA
>probe:Drosophila_2:1631756_at:282:673; Interrogation_Position=1674; Antisense; TACCCATCTGGTGTTCAAGCCGGAT
>probe:Drosophila_2:1631756_at:122:161; Interrogation_Position=1702; Antisense; ACAATGCTAACCGTGAGCCTGGCCA
>probe:Drosophila_2:1631756_at:51:435; Interrogation_Position=1756; Antisense; GAGGGTATGCGAAGTGCCACCAACA
>probe:Drosophila_2:1631756_at:617:421; Interrogation_Position=1783; Antisense; GAGAAGTCTCTCATGATGTCGATGT
>probe:Drosophila_2:1631756_at:401:455; Interrogation_Position=1818; Antisense; GATACAGCGCTGCAAACTTCTGGAG
>probe:Drosophila_2:1631756_at:171:253; Interrogation_Position=1860; Antisense; CAAGTTGAAGAAGCGCCTGACCACC
>probe:Drosophila_2:1631756_at:347:285; Interrogation_Position=1876; Antisense; CTGACCACCATCTTCTTGGAGGAGG
>probe:Drosophila_2:1631756_at:674:327; Interrogation_Position=2012; Antisense; GCGATTCGGAATTCAGCAAGGCTCT
>probe:Drosophila_2:1631756_at:708:167; Interrogation_Position=2061; Antisense; AAATGTCGCCATACAGCGTTCCAAG
>probe:Drosophila_2:1631756_at:250:315; Interrogation_Position=2095; Antisense; GCCATGGAGCGCACTGTATTCGAAA
>probe:Drosophila_2:1631756_at:469:9; Interrogation_Position=2112; Antisense; ATTCGAAATGCATCAGCCCATTCCT
>probe:Drosophila_2:1631756_at:579:301; Interrogation_Position=2128; Antisense; CCCATTCCTTGATTTCCTTGTTATA

Paste this into a BLAST search page for me
GATGTCTCACAAACGACCGATTCTCGACCGATTCTCACCATCAAATACAATACCCATCTGGTGTTCAAGCCGGATACAATGCTAACCGTGAGCCTGGCCAGAGGGTATGCGAAGTGCCACCAACAGAGAAGTCTCTCATGATGTCGATGTGATACAGCGCTGCAAACTTCTGGAGCAAGTTGAAGAAGCGCCTGACCACCCTGACCACCATCTTCTTGGAGGAGGGCGATTCGGAATTCAGCAAGGCTCTAAATGTCGCCATACAGCGTTCCAAGGCCATGGAGCGCACTGTATTCGAAAATTCGAAATGCATCAGCCCATTCCTCCCATTCCTTGATTTCCTTGTTATA

Full Affymetrix probeset data:

Annotations for 1631756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime