FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631757_at:

>probe:Drosophila_2:1631757_at:343:223; Interrogation_Position=156; Antisense; AAGGGTGCTGCCCAATTGGATGCAA
>probe:Drosophila_2:1631757_at:56:537; Interrogation_Position=173; Antisense; GGATGCAAAACCATTCCCGGACGAG
>probe:Drosophila_2:1631757_at:701:413; Interrogation_Position=195; Antisense; GAGCCCGTAACGTCGAGTGAGGAAA
>probe:Drosophila_2:1631757_at:180:219; Interrogation_Position=218; Antisense; AAGTCTATATCCTCGGGTTAGCCGT
>probe:Drosophila_2:1631757_at:131:683; Interrogation_Position=242; Antisense; TATGCTACGTCGGATGAGCTCTTCG
>probe:Drosophila_2:1631757_at:478:317; Interrogation_Position=316; Antisense; GCCTGAAGACACATCCGAACGAGCT
>probe:Drosophila_2:1631757_at:602:379; Interrogation_Position=332; Antisense; GAACGAGCTAGGCAACCAGTACCCG
>probe:Drosophila_2:1631757_at:8:579; Interrogation_Position=392; Antisense; GGCCAGCCCGACAGCTTATTTGGGA
>probe:Drosophila_2:1631757_at:686:11; Interrogation_Position=441; Antisense; ATATAGGGTCCGCTTTGTGTCAATA
>probe:Drosophila_2:1631757_at:553:161; Interrogation_Position=481; Antisense; AAATCAAAGTTTGCGCCGGTCGATA
>probe:Drosophila_2:1631757_at:78:573; Interrogation_Position=517; Antisense; GGCTCTCTGGCGGAAACACTTTGGA
>probe:Drosophila_2:1631757_at:132:571; Interrogation_Position=601; Antisense; GGCATTCAAGTTGCATCCAATCCGT
>probe:Drosophila_2:1631757_at:359:317; Interrogation_Position=655; Antisense; GCCTGGCTTGTGGTTTGCGTTTAAA
>probe:Drosophila_2:1631757_at:108:357; Interrogation_Position=691; Antisense; GCAAAATCAGCGCTCATGCAGTGGA

Paste this into a BLAST search page for me
AAGGGTGCTGCCCAATTGGATGCAAGGATGCAAAACCATTCCCGGACGAGGAGCCCGTAACGTCGAGTGAGGAAAAAGTCTATATCCTCGGGTTAGCCGTTATGCTACGTCGGATGAGCTCTTCGGCCTGAAGACACATCCGAACGAGCTGAACGAGCTAGGCAACCAGTACCCGGGCCAGCCCGACAGCTTATTTGGGAATATAGGGTCCGCTTTGTGTCAATAAAATCAAAGTTTGCGCCGGTCGATAGGCTCTCTGGCGGAAACACTTTGGAGGCATTCAAGTTGCATCCAATCCGTGCCTGGCTTGTGGTTTGCGTTTAAAGCAAAATCAGCGCTCATGCAGTGGA

Full Affymetrix probeset data:

Annotations for 1631757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720