Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631760_at:

>probe:Drosophila_2:1631760_at:180:509; Interrogation_Position=1001; Antisense; GTGCTGTCAATCACACATTTACACT
>probe:Drosophila_2:1631760_at:102:167; Interrogation_Position=1083; Antisense; AAATGTATTTTGTCGGTTCAACTAT
>probe:Drosophila_2:1631760_at:548:473; Interrogation_Position=1098; Antisense; GTTCAACTATTTACATCGCTCTCAT
>probe:Drosophila_2:1631760_at:409:271; Interrogation_Position=1111; Antisense; CATCGCTCTCATATGTTACGCATTT
>probe:Drosophila_2:1631760_at:375:705; Interrogation_Position=1126; Antisense; TTACGCATTTCAGACCAATTCGTTG
>probe:Drosophila_2:1631760_at:370:713; Interrogation_Position=1144; Antisense; TTCGTTGAATAATCCGGTGCACCCT
>probe:Drosophila_2:1631760_at:22:91; Interrogation_Position=1178; Antisense; AGTTCCCTGACTCATTTTCCTTTGA
>probe:Drosophila_2:1631760_at:505:629; Interrogation_Position=1195; Antisense; TCCTTTGATTTTTCTTTCCATTACT
>probe:Drosophila_2:1631760_at:581:101; Interrogation_Position=1243; Antisense; AGAGTTGCTCACATATGTCGCTTTT
>probe:Drosophila_2:1631760_at:77:63; Interrogation_Position=1257; Antisense; ATGTCGCTTTTGATTCTTTCCACTC
>probe:Drosophila_2:1631760_at:390:695; Interrogation_Position=1273; Antisense; TTTCCACTCGATTCTCATTCTGTCT
>probe:Drosophila_2:1631760_at:599:203; Interrogation_Position=1315; Antisense; AAGCCATTCTATCCACTTTACCCGA
>probe:Drosophila_2:1631760_at:196:259; Interrogation_Position=1328; Antisense; CACTTTACCCGAATGCACTTTGCAA
>probe:Drosophila_2:1631760_at:584:319; Interrogation_Position=973; Antisense; GCCCTCTGAAGGGTGTCAATACATA

Paste this into a BLAST search page for me
GTGCTGTCAATCACACATTTACACTAAATGTATTTTGTCGGTTCAACTATGTTCAACTATTTACATCGCTCTCATCATCGCTCTCATATGTTACGCATTTTTACGCATTTCAGACCAATTCGTTGTTCGTTGAATAATCCGGTGCACCCTAGTTCCCTGACTCATTTTCCTTTGATCCTTTGATTTTTCTTTCCATTACTAGAGTTGCTCACATATGTCGCTTTTATGTCGCTTTTGATTCTTTCCACTCTTTCCACTCGATTCTCATTCTGTCTAAGCCATTCTATCCACTTTACCCGACACTTTACCCGAATGCACTTTGCAAGCCCTCTGAAGGGTGTCAATACATA

Full Affymetrix probeset data:

Annotations for 1631760_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime