FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631761_at:

>probe:Drosophila_2:1631761_at:671:337; Interrogation_Position=155; Antisense; GCTAAGGAGCTCTTGGACACAACGC
>probe:Drosophila_2:1631761_at:266:191; Interrogation_Position=186; Antisense; AACTTGCCACAGGAGATGGTCCCAA
>probe:Drosophila_2:1631761_at:244:615; Interrogation_Position=222; Antisense; TGAATGTGATCTCGGCATCTAGCCA
>probe:Drosophila_2:1631761_at:41:573; Interrogation_Position=253; Antisense; GGCTGGGTCGCTCTACAAATTCGAG
>probe:Drosophila_2:1631761_at:63:3; Interrogation_Position=271; Antisense; ATTCGAGGTGAAGCTGTCCAACGGA
>probe:Drosophila_2:1631761_at:589:97; Interrogation_Position=321; Antisense; AGATCTGGGACAGGCCATGGCTGCA
>probe:Drosophila_2:1631761_at:269:437; Interrogation_Position=356; Antisense; GAGGCCACCAATGTGAAGGTCCAGT
>probe:Drosophila_2:1631761_at:534:81; Interrogation_Position=414; Antisense; AGGGCGTCATTGCTGTGTTTAACCA
>probe:Drosophila_2:1631761_at:126:171; Interrogation_Position=457; Antisense; AAAGGTGCAATCTCTGGTGCTTGAG
>probe:Drosophila_2:1631761_at:41:243; Interrogation_Position=494; Antisense; AATTTTTCGAAGCTTGCCTACTCCG
>probe:Drosophila_2:1631761_at:507:669; Interrogation_Position=512; Antisense; TACTCCGGTGACTCCCAGAAATGAT
>probe:Drosophila_2:1631761_at:356:85; Interrogation_Position=55; Antisense; AGTGATCTTTGTTCTGTCTGTGACC
>probe:Drosophila_2:1631761_at:336:331; Interrogation_Position=572; Antisense; GCGGATTGTGCAGTAACCAGTTTTT
>probe:Drosophila_2:1631761_at:465:469; Interrogation_Position=86; Antisense; GTTGCCTTTGCTAACCCGAGGTTGC

Paste this into a BLAST search page for me
GCTAAGGAGCTCTTGGACACAACGCAACTTGCCACAGGAGATGGTCCCAATGAATGTGATCTCGGCATCTAGCCAGGCTGGGTCGCTCTACAAATTCGAGATTCGAGGTGAAGCTGTCCAACGGAAGATCTGGGACAGGCCATGGCTGCAGAGGCCACCAATGTGAAGGTCCAGTAGGGCGTCATTGCTGTGTTTAACCAAAAGGTGCAATCTCTGGTGCTTGAGAATTTTTCGAAGCTTGCCTACTCCGTACTCCGGTGACTCCCAGAAATGATAGTGATCTTTGTTCTGTCTGTGACCGCGGATTGTGCAGTAACCAGTTTTTGTTGCCTTTGCTAACCCGAGGTTGC

Full Affymetrix probeset data:

Annotations for 1631761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720