FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631763_at:

>probe:Drosophila_2:1631763_at:84:245; Interrogation_Position=3775; Antisense; AATTTCGGAGTTGCCTTCGGGTCTG
>probe:Drosophila_2:1631763_at:536:715; Interrogation_Position=3790; Antisense; TTCGGGTCTGCAGAGCATCATATCT
>probe:Drosophila_2:1631763_at:355:345; Interrogation_Position=3804; Antisense; GCATCATATCTGAGGGCGGGACCAA
>probe:Drosophila_2:1631763_at:367:319; Interrogation_Position=3819; Antisense; GCGGGACCAACTTTAGCGTAGGCCA
>probe:Drosophila_2:1631763_at:59:681; Interrogation_Position=3837; Antisense; TAGGCCAACGCCAGTTAGTCTGCTT
>probe:Drosophila_2:1631763_at:380:677; Interrogation_Position=3852; Antisense; TAGTCTGCTTGGCAAGGGCCATTCT
>probe:Drosophila_2:1631763_at:61:169; Interrogation_Position=3916; Antisense; AAATGTGGATCCTCAGACGGACGCC
>probe:Drosophila_2:1631763_at:602:461; Interrogation_Position=3943; Antisense; GATTCAGGCCACCATTCGAAACAAA
>probe:Drosophila_2:1631763_at:468:557; Interrogation_Position=3973; Antisense; GGACTGCACAGTACTCACGATAGCT
>probe:Drosophila_2:1631763_at:29:295; Interrogation_Position=3990; Antisense; CGATAGCTCATCGTCTAAACACCAT
>probe:Drosophila_2:1631763_at:631:605; Interrogation_Position=4038; Antisense; TGATGGATGCTGGTCACGTCGTCGA
>probe:Drosophila_2:1631763_at:278:499; Interrogation_Position=4058; Antisense; GTCGAGTTCGGTTCTCCATATGAGC
>probe:Drosophila_2:1631763_at:695:307; Interrogation_Position=4073; Antisense; CCATATGAGCTGTTGACCGCGTCAA
>probe:Drosophila_2:1631763_at:23:393; Interrogation_Position=4134; Antisense; GAAAGGCCAGCTTTGATCATCTACT

Paste this into a BLAST search page for me
AATTTCGGAGTTGCCTTCGGGTCTGTTCGGGTCTGCAGAGCATCATATCTGCATCATATCTGAGGGCGGGACCAAGCGGGACCAACTTTAGCGTAGGCCATAGGCCAACGCCAGTTAGTCTGCTTTAGTCTGCTTGGCAAGGGCCATTCTAAATGTGGATCCTCAGACGGACGCCGATTCAGGCCACCATTCGAAACAAAGGACTGCACAGTACTCACGATAGCTCGATAGCTCATCGTCTAAACACCATTGATGGATGCTGGTCACGTCGTCGAGTCGAGTTCGGTTCTCCATATGAGCCCATATGAGCTGTTGACCGCGTCAAGAAAGGCCAGCTTTGATCATCTACT

Full Affymetrix probeset data:

Annotations for 1631763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720