FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631765_at:

>probe:Drosophila_2:1631765_at:54:247; Interrogation_Position=2339; Antisense; AATTGCAGCTTAAACTATGTACTTG
>probe:Drosophila_2:1631765_at:35:489; Interrogation_Position=2357; Antisense; GTACTTGCAATACCTTTTAAGAGCT
>probe:Drosophila_2:1631765_at:665:599; Interrogation_Position=2384; Antisense; TGTAATGTATTTCCTTTTCGCCCCT
>probe:Drosophila_2:1631765_at:127:389; Interrogation_Position=2483; Antisense; GAAAACCTCGTACATGTTAATTTAG
>probe:Drosophila_2:1631765_at:28:289; Interrogation_Position=2526; Antisense; CGATTCTTAACTTACCTACCTACAT
>probe:Drosophila_2:1631765_at:504:167; Interrogation_Position=2602; Antisense; AAATGCACTGCAACTATTTCTGCTG
>probe:Drosophila_2:1631765_at:333:689; Interrogation_Position=2616; Antisense; TATTTCTGCTGACTTGCCACACAAA
>probe:Drosophila_2:1631765_at:417:403; Interrogation_Position=2626; Antisense; GACTTGCCACACAAATCGAACCCAA
>probe:Drosophila_2:1631765_at:472:663; Interrogation_Position=2673; Antisense; TAAACCCCGCCATATGCACAGCAAA
>probe:Drosophila_2:1631765_at:145:473; Interrogation_Position=2713; Antisense; GTTCTAAGTTTTATCAATCCGCTAT
>probe:Drosophila_2:1631765_at:32:251; Interrogation_Position=2727; Antisense; CAATCCGCTATAGCCACTCTAATAG
>probe:Drosophila_2:1631765_at:30:449; Interrogation_Position=2850; Antisense; GATCGTAAGTCTATTAAGCTAAGCT
>probe:Drosophila_2:1631765_at:548:659; Interrogation_Position=2864; Antisense; TAAGCTAAGCTACACCTGAGCAGTG
>probe:Drosophila_2:1631765_at:494:131; Interrogation_Position=2877; Antisense; ACCTGAGCAGTGTAACGCGAATGCT

Paste this into a BLAST search page for me
AATTGCAGCTTAAACTATGTACTTGGTACTTGCAATACCTTTTAAGAGCTTGTAATGTATTTCCTTTTCGCCCCTGAAAACCTCGTACATGTTAATTTAGCGATTCTTAACTTACCTACCTACATAAATGCACTGCAACTATTTCTGCTGTATTTCTGCTGACTTGCCACACAAAGACTTGCCACACAAATCGAACCCAATAAACCCCGCCATATGCACAGCAAAGTTCTAAGTTTTATCAATCCGCTATCAATCCGCTATAGCCACTCTAATAGGATCGTAAGTCTATTAAGCTAAGCTTAAGCTAAGCTACACCTGAGCAGTGACCTGAGCAGTGTAACGCGAATGCT

Full Affymetrix probeset data:

Annotations for 1631765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720