FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631766_at:

>probe:Drosophila_2:1631766_at:92:341; Interrogation_Position=1012; Antisense; GCTAGCGATTGGTTTTGCGATCAAA
>probe:Drosophila_2:1631766_at:42:41; Interrogation_Position=1038; Antisense; ATCGGCTTCGGAACTGTTTGAGCAC
>probe:Drosophila_2:1631766_at:469:93; Interrogation_Position=1099; Antisense; AGTTCTTTGTGCTCTTCATTTCTGG
>probe:Drosophila_2:1631766_at:441:17; Interrogation_Position=1116; Antisense; ATTTCTGGCCCGTAACAATGTTGAT
>probe:Drosophila_2:1631766_at:715:655; Interrogation_Position=1154; Antisense; TAATCGAGGCGTTCTTGCAGCACCA
>probe:Drosophila_2:1631766_at:374:303; Interrogation_Position=1203; Antisense; CCTCAGCTTGCTCTTTAACTATCAA
>probe:Drosophila_2:1631766_at:134:225; Interrogation_Position=1237; Antisense; AAGGATCTGCGAGCCTGCGCTGAGA
>probe:Drosophila_2:1631766_at:34:103; Interrogation_Position=1340; Antisense; AGAGCGATCCTGTGGACTCTTCGGG
>probe:Drosophila_2:1631766_at:702:403; Interrogation_Position=1354; Antisense; GACTCTTCGGGAATGGCCAGCAAGT
>probe:Drosophila_2:1631766_at:162:257; Interrogation_Position=1399; Antisense; CAGTACAAGTTCTAGTCCCCAGTTT
>probe:Drosophila_2:1631766_at:498:91; Interrogation_Position=1419; Antisense; AGTTTCCATCGTTAAGCCGTTGTCA
>probe:Drosophila_2:1631766_at:341:317; Interrogation_Position=1434; Antisense; GCCGTTGTCATCGTAGTTACAGCAC
>probe:Drosophila_2:1631766_at:373:421; Interrogation_Position=1475; Antisense; GAGCAATATTGCAAGCATCCCCATA
>probe:Drosophila_2:1631766_at:702:559; Interrogation_Position=998; Antisense; GGAAGCAATGCTTCGCTAGCGATTG

Paste this into a BLAST search page for me
GCTAGCGATTGGTTTTGCGATCAAAATCGGCTTCGGAACTGTTTGAGCACAGTTCTTTGTGCTCTTCATTTCTGGATTTCTGGCCCGTAACAATGTTGATTAATCGAGGCGTTCTTGCAGCACCACCTCAGCTTGCTCTTTAACTATCAAAAGGATCTGCGAGCCTGCGCTGAGAAGAGCGATCCTGTGGACTCTTCGGGGACTCTTCGGGAATGGCCAGCAAGTCAGTACAAGTTCTAGTCCCCAGTTTAGTTTCCATCGTTAAGCCGTTGTCAGCCGTTGTCATCGTAGTTACAGCACGAGCAATATTGCAAGCATCCCCATAGGAAGCAATGCTTCGCTAGCGATTG

Full Affymetrix probeset data:

Annotations for 1631766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720