FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631767_at:

>probe:Drosophila_2:1631767_at:432:613; Interrogation_Position=110; Antisense; TGAACAGCCGGAATTCCAGCTATCT
>probe:Drosophila_2:1631767_at:2:179; Interrogation_Position=172; Antisense; AAACTCTGGATGTCGGATTTGCGCA
>probe:Drosophila_2:1631767_at:281:107; Interrogation_Position=230; Antisense; AGAACTTCTTCTTCGCCAATAGCTA
>probe:Drosophila_2:1631767_at:635:599; Interrogation_Position=262; Antisense; TGCTACAACTTTGCCATGGACCTAA
>probe:Drosophila_2:1631767_at:379:549; Interrogation_Position=327; Antisense; GGAGGATACGCAGTCGGGCTACTAC
>probe:Drosophila_2:1631767_at:457:523; Interrogation_Position=342; Antisense; GGGCTACTACTACACGAACTTCGAC
>probe:Drosophila_2:1631767_at:287:715; Interrogation_Position=361; Antisense; TTCGACGGGAATCCGGTCATTCAGA
>probe:Drosophila_2:1631767_at:122:195; Interrogation_Position=393; Antisense; AACTGCTTGTCTTTTGCTGGGAACT
>probe:Drosophila_2:1631767_at:279:593; Interrogation_Position=410; Antisense; TGGGAACTTCAACTCTGGTACTCTG
>probe:Drosophila_2:1631767_at:432:271; Interrogation_Position=441; Antisense; CATCTCGTTTCTAATGTTCGCCATT
>probe:Drosophila_2:1631767_at:599:361; Interrogation_Position=468; Antisense; GCAATGGAAGGCATCTCGGCTGCGA
>probe:Drosophila_2:1631767_at:161:111; Interrogation_Position=496; Antisense; AGCAAGTCAGTCCAAGGCGGTCCAT
>probe:Drosophila_2:1631767_at:313:249; Interrogation_Position=66; Antisense; CAATCGGCTGATCATTCCCAAGGAT
>probe:Drosophila_2:1631767_at:589:77; Interrogation_Position=86; Antisense; AGGATCCCTACAGTATCTTCAAGCT

Paste this into a BLAST search page for me
TGAACAGCCGGAATTCCAGCTATCTAAACTCTGGATGTCGGATTTGCGCAAGAACTTCTTCTTCGCCAATAGCTATGCTACAACTTTGCCATGGACCTAAGGAGGATACGCAGTCGGGCTACTACGGGCTACTACTACACGAACTTCGACTTCGACGGGAATCCGGTCATTCAGAAACTGCTTGTCTTTTGCTGGGAACTTGGGAACTTCAACTCTGGTACTCTGCATCTCGTTTCTAATGTTCGCCATTGCAATGGAAGGCATCTCGGCTGCGAAGCAAGTCAGTCCAAGGCGGTCCATCAATCGGCTGATCATTCCCAAGGATAGGATCCCTACAGTATCTTCAAGCT

Full Affymetrix probeset data:

Annotations for 1631767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720