FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631768_at:

>probe:Drosophila_2:1631768_at:327:111; Interrogation_Position=1056; Antisense; AGAATATGATCGCTATGCCACACCG
>probe:Drosophila_2:1631768_at:361:135; Interrogation_Position=1112; Antisense; ACGCCCAGTATGACAGTAGCTCCTA
>probe:Drosophila_2:1631768_at:159:91; Interrogation_Position=1126; Antisense; AGTAGCTCCTACGAGCGCGACTATC
>probe:Drosophila_2:1631768_at:41:325; Interrogation_Position=1142; Antisense; GCGACTATCGGCGTGAGTATCACCC
>probe:Drosophila_2:1631768_at:452:567; Interrogation_Position=1191; Antisense; GGCGGCCTATCCAGCAAAACCAAGC
>probe:Drosophila_2:1631768_at:129:211; Interrogation_Position=1212; Antisense; AAGCAACGGTCGTTCATCATCGTCA
>probe:Drosophila_2:1631768_at:363:645; Interrogation_Position=1225; Antisense; TCATCATCGTCATATCGACCAACCA
>probe:Drosophila_2:1631768_at:476:639; Interrogation_Position=1252; Antisense; TCGGGCTCGGGATCACATTCATCTG
>probe:Drosophila_2:1631768_at:202:13; Interrogation_Position=1268; Antisense; ATTCATCTGCTCACTACGAAACTGG
>probe:Drosophila_2:1631768_at:145:545; Interrogation_Position=1291; Antisense; GGATCCCGATCTCGTGAAAGCGTGC
>probe:Drosophila_2:1631768_at:283:393; Interrogation_Position=1306; Antisense; GAAAGCGTGCGATATCGCTCGGCTC
>probe:Drosophila_2:1631768_at:538:571; Interrogation_Position=1326; Antisense; GGCTCCATATCCGAAAATACGTTAA
>probe:Drosophila_2:1631768_at:372:185; Interrogation_Position=1482; Antisense; AACAATCCAACTATTCACACCTATT
>probe:Drosophila_2:1631768_at:211:5; Interrogation_Position=1552; Antisense; ATTGCAACTGTTGTCCGATATTCAA

Paste this into a BLAST search page for me
AGAATATGATCGCTATGCCACACCGACGCCCAGTATGACAGTAGCTCCTAAGTAGCTCCTACGAGCGCGACTATCGCGACTATCGGCGTGAGTATCACCCGGCGGCCTATCCAGCAAAACCAAGCAAGCAACGGTCGTTCATCATCGTCATCATCATCGTCATATCGACCAACCATCGGGCTCGGGATCACATTCATCTGATTCATCTGCTCACTACGAAACTGGGGATCCCGATCTCGTGAAAGCGTGCGAAAGCGTGCGATATCGCTCGGCTCGGCTCCATATCCGAAAATACGTTAAAACAATCCAACTATTCACACCTATTATTGCAACTGTTGTCCGATATTCAA

Full Affymetrix probeset data:

Annotations for 1631768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720