FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631769_at:

>probe:Drosophila_2:1631769_at:650:91; Interrogation_Position=2143; Antisense; AGTTTGTAGTACCATTATAAGCAGC
>probe:Drosophila_2:1631769_at:51:343; Interrogation_Position=2237; Antisense; GCTTAACATGCCAACGATTCTTTGT
>probe:Drosophila_2:1631769_at:707:635; Interrogation_Position=2285; Antisense; TCGACTCATTCGATGTTAACCCGAG
>probe:Drosophila_2:1631769_at:239:643; Interrogation_Position=2301; Antisense; TAACCCGAGTTCTTAAATCTGTTGG
>probe:Drosophila_2:1631769_at:730:379; Interrogation_Position=2332; Antisense; GTGGAAACGTACACTAAGCAACTTT
>probe:Drosophila_2:1631769_at:244:419; Interrogation_Position=2364; Antisense; GAGCATTAGCTATGTCCAGAGACGT
>probe:Drosophila_2:1631769_at:531:405; Interrogation_Position=2384; Antisense; GACGTGGTAGTTGCTAATCCGACAT
>probe:Drosophila_2:1631769_at:387:235; Interrogation_Position=2399; Antisense; AATCCGACATTGACTTCATTGACTG
>probe:Drosophila_2:1631769_at:502:139; Interrogation_Position=2460; Antisense; ACGTACAATTTGTTTTGCCCTCTGG
>probe:Drosophila_2:1631769_at:393:635; Interrogation_Position=2480; Antisense; TCTGGCAGTAGCCTGTGTGCATATG
>probe:Drosophila_2:1631769_at:47:469; Interrogation_Position=2511; Antisense; GTTGAAAATTATCGTCAAGCCTTTT
>probe:Drosophila_2:1631769_at:719:17; Interrogation_Position=2549; Antisense; ATTTGTACGTTATCGAATGTCTTCA
>probe:Drosophila_2:1631769_at:401:699; Interrogation_Position=2650; Antisense; TTTTATTTCGCGCTCAAACGTGCAT
>probe:Drosophila_2:1631769_at:598:139; Interrogation_Position=2667; Antisense; ACGTGCATGCGTTTTAATGTTGTAT

Paste this into a BLAST search page for me
AGTTTGTAGTACCATTATAAGCAGCGCTTAACATGCCAACGATTCTTTGTTCGACTCATTCGATGTTAACCCGAGTAACCCGAGTTCTTAAATCTGTTGGGTGGAAACGTACACTAAGCAACTTTGAGCATTAGCTATGTCCAGAGACGTGACGTGGTAGTTGCTAATCCGACATAATCCGACATTGACTTCATTGACTGACGTACAATTTGTTTTGCCCTCTGGTCTGGCAGTAGCCTGTGTGCATATGGTTGAAAATTATCGTCAAGCCTTTTATTTGTACGTTATCGAATGTCTTCATTTTATTTCGCGCTCAAACGTGCATACGTGCATGCGTTTTAATGTTGTAT

Full Affymetrix probeset data:

Annotations for 1631769_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720