FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631770_at:

>probe:Drosophila_2:1631770_at:293:135; Interrogation_Position=107; Antisense; ACGCTGGGTTGTGTACTTGTGTAAA
>probe:Drosophila_2:1631770_at:127:129; Interrogation_Position=131; Antisense; ACCGATGTGGAAATGCCCTGCGATT
>probe:Drosophila_2:1631770_at:152:51; Interrogation_Position=143; Antisense; ATGCCCTGCGATTGCGTGTTATCAA
>probe:Drosophila_2:1631770_at:673:379; Interrogation_Position=250; Antisense; GAACCTGCGGCAGCTGCTAGGATTG
>probe:Drosophila_2:1631770_at:364:671; Interrogation_Position=272; Antisense; TTGCCAGTTGGACAGTCGGGACACT
>probe:Drosophila_2:1631770_at:565:527; Interrogation_Position=289; Antisense; GGGACACTGCCAGGATTGCCAGGAT
>probe:Drosophila_2:1631770_at:44:43; Interrogation_Position=312; Antisense; ATCGTGTTCTGTTGTGTTATGCTGC
>probe:Drosophila_2:1631770_at:515:683; Interrogation_Position=329; Antisense; TATGCTGCGTTGTTGTTGGCCAAGC
>probe:Drosophila_2:1631770_at:501:729; Interrogation_Position=344; Antisense; TTGGCCAAGCCAACCGTTGTTGTTG
>probe:Drosophila_2:1631770_at:480:349; Interrogation_Position=447; Antisense; GCAGGACCAGAACCAGCACCAGAAA
>probe:Drosophila_2:1631770_at:576:135; Interrogation_Position=491; Antisense; ACAGACCGGAACAGGACCACCAAGA
>probe:Drosophila_2:1631770_at:91:141; Interrogation_Position=522; Antisense; ACGGAGTTATTGTGGTGGCACCGCC
>probe:Drosophila_2:1631770_at:82:351; Interrogation_Position=576; Antisense; GCAGTATCCTGCACTATAGGCACAT
>probe:Drosophila_2:1631770_at:520:11; Interrogation_Position=64; Antisense; ATTCAAAGTTGCACGATACCAGCGA

Paste this into a BLAST search page for me
ACGCTGGGTTGTGTACTTGTGTAAAACCGATGTGGAAATGCCCTGCGATTATGCCCTGCGATTGCGTGTTATCAAGAACCTGCGGCAGCTGCTAGGATTGTTGCCAGTTGGACAGTCGGGACACTGGGACACTGCCAGGATTGCCAGGATATCGTGTTCTGTTGTGTTATGCTGCTATGCTGCGTTGTTGTTGGCCAAGCTTGGCCAAGCCAACCGTTGTTGTTGGCAGGACCAGAACCAGCACCAGAAAACAGACCGGAACAGGACCACCAAGAACGGAGTTATTGTGGTGGCACCGCCGCAGTATCCTGCACTATAGGCACATATTCAAAGTTGCACGATACCAGCGA

Full Affymetrix probeset data:

Annotations for 1631770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720