FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631773_at:

>probe:Drosophila_2:1631773_at:169:305; Interrogation_Position=107; Antisense; CCTACGAGTTCCAGTGGTCGGTGAA
>probe:Drosophila_2:1631773_at:541:399; Interrogation_Position=156; Antisense; GAGCCAAAAGGAGTCCCGCAAGGAC
>probe:Drosophila_2:1631773_at:332:435; Interrogation_Position=190; Antisense; GAGGGTGTCTACGAGCTGATCGATT
>probe:Drosophila_2:1631773_at:12:585; Interrogation_Position=219; Antisense; TGGCTATCGCCGCATAGTGCAGTAC
>probe:Drosophila_2:1631773_at:140:93; Interrogation_Position=24; Antisense; AGTTACCTATTTGTTGTGCCTGTGC
>probe:Drosophila_2:1631773_at:699:67; Interrogation_Position=245; Antisense; AGGCGGATGATCACAACGGTTTCGA
>probe:Drosophila_2:1631773_at:332:717; Interrogation_Position=265; Antisense; TTCGAGGCAATTGTCCAGCGTGAGC
>probe:Drosophila_2:1631773_at:204:513; Interrogation_Position=284; Antisense; GTGAGCCCACGGACATCAAGATACC
>probe:Drosophila_2:1631773_at:442:33; Interrogation_Position=298; Antisense; ATCAAGATACCGTTGCCTGAGCCAC
>probe:Drosophila_2:1631773_at:643:15; Interrogation_Position=403; Antisense; ATTATCAAGCAGGAGCTGTCCGCCG
>probe:Drosophila_2:1631773_at:41:505; Interrogation_Position=420; Antisense; GTCCGCCGGGAACTATGTCTCTGTA
>probe:Drosophila_2:1631773_at:62:193; Interrogation_Position=430; Antisense; AACTATGTCTCTGTATCCGGACCAA
>probe:Drosophila_2:1631773_at:616:631; Interrogation_Position=445; Antisense; TCCGGACCAACAGCACAGTACAAGT
>probe:Drosophila_2:1631773_at:589:311; Interrogation_Position=52; Antisense; GCCAGCGCCGTTTGGGCCATTGAAT

Paste this into a BLAST search page for me
CCTACGAGTTCCAGTGGTCGGTGAAGAGCCAAAAGGAGTCCCGCAAGGACGAGGGTGTCTACGAGCTGATCGATTTGGCTATCGCCGCATAGTGCAGTACAGTTACCTATTTGTTGTGCCTGTGCAGGCGGATGATCACAACGGTTTCGATTCGAGGCAATTGTCCAGCGTGAGCGTGAGCCCACGGACATCAAGATACCATCAAGATACCGTTGCCTGAGCCACATTATCAAGCAGGAGCTGTCCGCCGGTCCGCCGGGAACTATGTCTCTGTAAACTATGTCTCTGTATCCGGACCAATCCGGACCAACAGCACAGTACAAGTGCCAGCGCCGTTTGGGCCATTGAAT

Full Affymetrix probeset data:

Annotations for 1631773_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720