FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631774_at:

>probe:Drosophila_2:1631774_at:419:381; Interrogation_Position=124; Antisense; GAACCGGAGCCCATCCATGAGTATG
>probe:Drosophila_2:1631774_at:496:483; Interrogation_Position=144; Antisense; GTATGGCCACCATCAAATCGAACGC
>probe:Drosophila_2:1631774_at:336:237; Interrogation_Position=159; Antisense; AATCGAACGCATCTCACTGGGCGAG
>probe:Drosophila_2:1631774_at:433:13; Interrogation_Position=18; Antisense; ATTCAAGTATCTGATCTTCGCCTCG
>probe:Drosophila_2:1631774_at:8:413; Interrogation_Position=222; Antisense; GACCCACGAGTCTCACGGACATGAT
>probe:Drosophila_2:1631774_at:339:63; Interrogation_Position=251; Antisense; ATGTGGATTACTATGCTCCTCCCAA
>probe:Drosophila_2:1631774_at:496:163; Interrogation_Position=274; Antisense; AAATATGCTTTCAAGTACGGCGTGA
>probe:Drosophila_2:1631774_at:198:511; Interrogation_Position=295; Antisense; GTGAATGACTTCCACACCGGAGATG
>probe:Drosophila_2:1631774_at:296:425; Interrogation_Position=334; Antisense; GAGACCCGCGATGGTGACACCGTCA
>probe:Drosophila_2:1631774_at:599:159; Interrogation_Position=419; Antisense; ACAAGCACAATGGATTCAACGCCGT
>probe:Drosophila_2:1631774_at:217:103; Interrogation_Position=452; Antisense; AGACCGCTCCAGTGCATCATCATGA
>probe:Drosophila_2:1631774_at:504:553; Interrogation_Position=477; Antisense; GGAGCTGCACGAACACCACTACTAA
>probe:Drosophila_2:1631774_at:29:635; Interrogation_Position=59; Antisense; TCGCCTATCCGTTGGAGCACCAGTA
>probe:Drosophila_2:1631774_at:5:67; Interrogation_Position=98; Antisense; ATGGATATGAGCACCTGGCCCATCA

Paste this into a BLAST search page for me
GAACCGGAGCCCATCCATGAGTATGGTATGGCCACCATCAAATCGAACGCAATCGAACGCATCTCACTGGGCGAGATTCAAGTATCTGATCTTCGCCTCGGACCCACGAGTCTCACGGACATGATATGTGGATTACTATGCTCCTCCCAAAAATATGCTTTCAAGTACGGCGTGAGTGAATGACTTCCACACCGGAGATGGAGACCCGCGATGGTGACACCGTCAACAAGCACAATGGATTCAACGCCGTAGACCGCTCCAGTGCATCATCATGAGGAGCTGCACGAACACCACTACTAATCGCCTATCCGTTGGAGCACCAGTAATGGATATGAGCACCTGGCCCATCA

Full Affymetrix probeset data:

Annotations for 1631774_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720