Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631775_at:

>probe:Drosophila_2:1631775_at:404:565; Interrogation_Position=130; Antisense; GGCGCTGGACTTTAACGGGAGCAAA
>probe:Drosophila_2:1631775_at:156:181; Interrogation_Position=152; Antisense; AAAAATGCTGATATTCCTTCGCCGC
>probe:Drosophila_2:1631775_at:54:573; Interrogation_Position=179; Antisense; GGCTACAATCCATCTGCTTTGGTGA
>probe:Drosophila_2:1631775_at:160:209; Interrogation_Position=242; Antisense; AAGAAGTCGTGGGACCTTGCCCTGG
>probe:Drosophila_2:1631775_at:12:723; Interrogation_Position=258; Antisense; TTGCCCTGGGACCTCTTAAGAACAT
>probe:Drosophila_2:1631775_at:388:637; Interrogation_Position=320; Antisense; TCGATTTCCATTTTTCCCATCATGA
>probe:Drosophila_2:1631775_at:708:347; Interrogation_Position=351; Antisense; GCATGATGCTGATCCGGCCTATCAA
>probe:Drosophila_2:1631775_at:643:127; Interrogation_Position=386; Antisense; ACCACCCAGGTGACTTCCAAAATGG
>probe:Drosophila_2:1631775_at:35:83; Interrogation_Position=423; Antisense; AGGGAACTGGCCAGCGCATCGTCTA
>probe:Drosophila_2:1631775_at:556:667; Interrogation_Position=446; Antisense; TACTTCCTGGGCAACCTAGCAAACG
>probe:Drosophila_2:1631775_at:410:671; Interrogation_Position=462; Antisense; TAGCAAACGTGGCTTTGGCCCTCTA
>probe:Drosophila_2:1631775_at:710:581; Interrogation_Position=477; Antisense; TGGCCCTCTACAAGTGCCAGAGCAT
>probe:Drosophila_2:1631775_at:355:465; Interrogation_Position=527; Antisense; GATTGGTTGGCATTTGTCCAGCCTC
>probe:Drosophila_2:1631775_at:722:211; Interrogation_Position=82; Antisense; AAGAAAGCACAGCATGTCCGCCAAG

Paste this into a BLAST search page for me
GGCGCTGGACTTTAACGGGAGCAAAAAAAATGCTGATATTCCTTCGCCGCGGCTACAATCCATCTGCTTTGGTGAAAGAAGTCGTGGGACCTTGCCCTGGTTGCCCTGGGACCTCTTAAGAACATTCGATTTCCATTTTTCCCATCATGAGCATGATGCTGATCCGGCCTATCAAACCACCCAGGTGACTTCCAAAATGGAGGGAACTGGCCAGCGCATCGTCTATACTTCCTGGGCAACCTAGCAAACGTAGCAAACGTGGCTTTGGCCCTCTATGGCCCTCTACAAGTGCCAGAGCATGATTGGTTGGCATTTGTCCAGCCTCAAGAAAGCACAGCATGTCCGCCAAG

Full Affymetrix probeset data:

Annotations for 1631775_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime