FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631776_at:

>probe:Drosophila_2:1631776_at:547:467; Interrogation_Position=1051; Antisense; GTTGTTTTCCATAACTCCATTTGCC
>probe:Drosophila_2:1631776_at:15:273; Interrogation_Position=1068; Antisense; CATTTGCCGTTCTCCGTTCAAAAAG
>probe:Drosophila_2:1631776_at:417:365; Interrogation_Position=1097; Antisense; GAATACCGTCTGTTGTTTTGCAAAC
>probe:Drosophila_2:1631776_at:263:477; Interrogation_Position=1111; Antisense; GTTTTGCAAACATCGAAGCGCCCAA
>probe:Drosophila_2:1631776_at:674:219; Interrogation_Position=1134; Antisense; AAGGTGCCGCCCCAAAGTCTTACAG
>probe:Drosophila_2:1631776_at:609:485; Interrogation_Position=1150; Antisense; GTCTTACAGCTTCCCGTAACTATAA
>probe:Drosophila_2:1631776_at:185:649; Interrogation_Position=1199; Antisense; TCACTTCCTTCATGACTGCCATAAT
>probe:Drosophila_2:1631776_at:51:569; Interrogation_Position=1248; Antisense; GGCAGTCCCACATACATAATAGCTT
>probe:Drosophila_2:1631776_at:448:27; Interrogation_Position=1309; Antisense; ATAGCCATCTCCTTCGTTGATTTTT
>probe:Drosophila_2:1631776_at:396:19; Interrogation_Position=854; Antisense; ATTTGCCGCTTTCATTGACACCTTC
>probe:Drosophila_2:1631776_at:497:513; Interrogation_Position=894; Antisense; GTGATGGTGGTCATGTCGGATCCCA
>probe:Drosophila_2:1631776_at:214:639; Interrogation_Position=927; Antisense; TCGGAGGCTACGCTAGTCAACATAA
>probe:Drosophila_2:1631776_at:419:493; Interrogation_Position=942; Antisense; GTCAACATAAGGAACGCTCGGAAGT
>probe:Drosophila_2:1631776_at:610:209; Interrogation_Position=989; Antisense; AAGCAACAGTGCCATTAACCATCAT

Paste this into a BLAST search page for me
GTTGTTTTCCATAACTCCATTTGCCCATTTGCCGTTCTCCGTTCAAAAAGGAATACCGTCTGTTGTTTTGCAAACGTTTTGCAAACATCGAAGCGCCCAAAAGGTGCCGCCCCAAAGTCTTACAGGTCTTACAGCTTCCCGTAACTATAATCACTTCCTTCATGACTGCCATAATGGCAGTCCCACATACATAATAGCTTATAGCCATCTCCTTCGTTGATTTTTATTTGCCGCTTTCATTGACACCTTCGTGATGGTGGTCATGTCGGATCCCATCGGAGGCTACGCTAGTCAACATAAGTCAACATAAGGAACGCTCGGAAGTAAGCAACAGTGCCATTAACCATCAT

Full Affymetrix probeset data:

Annotations for 1631776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720