FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631778_at:

>probe:Drosophila_2:1631778_at:248:471; Interrogation_Position=113; Antisense; GTTCCTGTGCTGTGTGGCACAGGAA
>probe:Drosophila_2:1631778_at:555:13; Interrogation_Position=149; Antisense; ATATCTGCCAGAGGGAAGGGCGAAC
>probe:Drosophila_2:1631778_at:501:395; Interrogation_Position=16; Antisense; GAAATCAAGTTCCTAATTGTCCTGT
>probe:Drosophila_2:1631778_at:306:373; Interrogation_Position=163; Antisense; GAAGGGCGAACCAGTGGACACTGCA
>probe:Drosophila_2:1631778_at:127:203; Interrogation_Position=171; Antisense; AACCAGTGGACACTGCAGCCCCAGT
>probe:Drosophila_2:1631778_at:230:31; Interrogation_Position=19; Antisense; ATCAAGTTCCTAATTGTCCTGTCCG
>probe:Drosophila_2:1631778_at:663:215; Interrogation_Position=22; Antisense; AAGTTCCTAATTGTCCTGTCCGCTG
>probe:Drosophila_2:1631778_at:222:655; Interrogation_Position=29; Antisense; TAATTGTCCTGTCCGCTGTCTTGAT
>probe:Drosophila_2:1631778_at:582:629; Interrogation_Position=35; Antisense; TCCTGTCCGCTGTCTTGATGATAAT
>probe:Drosophila_2:1631778_at:386:503; Interrogation_Position=39; Antisense; GTCCGCTGTCTTGATGATAATTTTC
>probe:Drosophila_2:1631778_at:547:333; Interrogation_Position=43; Antisense; GCTGTCTTGATGATAATTTTCCTGG
>probe:Drosophila_2:1631778_at:374:725; Interrogation_Position=49; Antisense; TTGATGATAATTTTCCTGGGAGCGG
>probe:Drosophila_2:1631778_at:544:15; Interrogation_Position=58; Antisense; ATTTTCCTGGGAGCGGAAGAATCAC
>probe:Drosophila_2:1631778_at:449:375; Interrogation_Position=73; Antisense; GAAGAATCACATGCCGACTGCCTTT

Paste this into a BLAST search page for me
GTTCCTGTGCTGTGTGGCACAGGAAATATCTGCCAGAGGGAAGGGCGAACGAAATCAAGTTCCTAATTGTCCTGTGAAGGGCGAACCAGTGGACACTGCAAACCAGTGGACACTGCAGCCCCAGTATCAAGTTCCTAATTGTCCTGTCCGAAGTTCCTAATTGTCCTGTCCGCTGTAATTGTCCTGTCCGCTGTCTTGATTCCTGTCCGCTGTCTTGATGATAATGTCCGCTGTCTTGATGATAATTTTCGCTGTCTTGATGATAATTTTCCTGGTTGATGATAATTTTCCTGGGAGCGGATTTTCCTGGGAGCGGAAGAATCACGAAGAATCACATGCCGACTGCCTTT

Full Affymetrix probeset data:

Annotations for 1631778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720