FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631780_at:

>probe:Drosophila_2:1631780_at:714:329; Interrogation_Position=1071; Antisense; GCGGGAGCTGGTTTATTTGTGATAC
>probe:Drosophila_2:1631780_at:500:455; Interrogation_Position=1091; Antisense; GATACACTTCGCTTTGTACATAGTT
>probe:Drosophila_2:1631780_at:350:333; Interrogation_Position=570; Antisense; GCTGGCACATCAGGCGGTCAAGGAT
>probe:Drosophila_2:1631780_at:247:653; Interrogation_Position=587; Antisense; TCAAGGATCGGTTGGCAGCTGCCTT
>probe:Drosophila_2:1631780_at:38:407; Interrogation_Position=623; Antisense; GACGGATCGGACATCCCTACCAGAA
>probe:Drosophila_2:1631780_at:65:435; Interrogation_Position=663; Antisense; GAGGAAAAAGCCACGCACATCCTTC
>probe:Drosophila_2:1631780_at:116:713; Interrogation_Position=685; Antisense; TTCACGCGCATCCAGGTGGCCGAGT
>probe:Drosophila_2:1631780_at:233:319; Interrogation_Position=703; Antisense; GCCGAGTTGGAGAAGCGCTTCCACA
>probe:Drosophila_2:1631780_at:583:171; Interrogation_Position=732; Antisense; AAAGTATCTGGCATCCGCGGAGCGA
>probe:Drosophila_2:1631780_at:709:139; Interrogation_Position=762; Antisense; ACTGGCCCGCGGACTGAAGATGACC
>probe:Drosophila_2:1631780_at:123:57; Interrogation_Position=781; Antisense; ATGACCGATGCCCAGGTGAAGACGT
>probe:Drosophila_2:1631780_at:708:385; Interrogation_Position=876; Antisense; GAACAGACTGATGCTGTCCCTCCAG
>probe:Drosophila_2:1631780_at:691:439; Interrogation_Position=904; Antisense; GAGGCCATCAGCAAGGGATTCGCGC
>probe:Drosophila_2:1631780_at:421:331; Interrogation_Position=975; Antisense; GCTGGCTGCGTTGCACGGACTACAG

Paste this into a BLAST search page for me
GCGGGAGCTGGTTTATTTGTGATACGATACACTTCGCTTTGTACATAGTTGCTGGCACATCAGGCGGTCAAGGATTCAAGGATCGGTTGGCAGCTGCCTTGACGGATCGGACATCCCTACCAGAAGAGGAAAAAGCCACGCACATCCTTCTTCACGCGCATCCAGGTGGCCGAGTGCCGAGTTGGAGAAGCGCTTCCACAAAAGTATCTGGCATCCGCGGAGCGAACTGGCCCGCGGACTGAAGATGACCATGACCGATGCCCAGGTGAAGACGTGAACAGACTGATGCTGTCCCTCCAGGAGGCCATCAGCAAGGGATTCGCGCGCTGGCTGCGTTGCACGGACTACAG

Full Affymetrix probeset data:

Annotations for 1631780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720