FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631781_at:

>probe:Drosophila_2:1631781_at:604:547; Interrogation_Position=1005; Antisense; GGATGTTGAAAACTTCGCCACCAGT
>probe:Drosophila_2:1631781_at:483:71; Interrogation_Position=1037; Antisense; AGGCGGTGATGCATCGGATCTCCAC
>probe:Drosophila_2:1631781_at:421:153; Interrogation_Position=1076; Antisense; ACATGGACTTCGTGCACTCTATGAC
>probe:Drosophila_2:1631781_at:505:681; Interrogation_Position=1095; Antisense; TATGACCGTCGCTAATGTGATTAAC
>probe:Drosophila_2:1631781_at:694:479; Interrogation_Position=1146; Antisense; GTTTGAGCAACCTATCGACTGTAAA
>probe:Drosophila_2:1631781_at:673:395; Interrogation_Position=599; Antisense; GACAAATTTTTCTCAGGACGCTCAT
>probe:Drosophila_2:1631781_at:59:557; Interrogation_Position=614; Antisense; GGACGCTCATAATGTCTATGCCCGA
>probe:Drosophila_2:1631781_at:623:319; Interrogation_Position=633; Antisense; GCCCGACTGCGAATTTATGTTCCAC
>probe:Drosophila_2:1631781_at:321:243; Interrogation_Position=687; Antisense; AATTTGTGGGCTTTTCGTTGTGAGG
>probe:Drosophila_2:1631781_at:700:513; Interrogation_Position=712; Antisense; GTGTACTGTTCGACCTTTTTTATGA
>probe:Drosophila_2:1631781_at:400:159; Interrogation_Position=767; Antisense; ACACAAGTGCGATTCCTCTGATTGC
>probe:Drosophila_2:1631781_at:97:151; Interrogation_Position=893; Antisense; ACTTGATCAACTACAGGAGCCTCAC
>probe:Drosophila_2:1631781_at:556:313; Interrogation_Position=957; Antisense; GCCAGTCCACATATTTTATAGCGAT
>probe:Drosophila_2:1631781_at:469:687; Interrogation_Position=973; Antisense; TATAGCGATGATGACCTATCCGCCG

Paste this into a BLAST search page for me
GGATGTTGAAAACTTCGCCACCAGTAGGCGGTGATGCATCGGATCTCCACACATGGACTTCGTGCACTCTATGACTATGACCGTCGCTAATGTGATTAACGTTTGAGCAACCTATCGACTGTAAAGACAAATTTTTCTCAGGACGCTCATGGACGCTCATAATGTCTATGCCCGAGCCCGACTGCGAATTTATGTTCCACAATTTGTGGGCTTTTCGTTGTGAGGGTGTACTGTTCGACCTTTTTTATGAACACAAGTGCGATTCCTCTGATTGCACTTGATCAACTACAGGAGCCTCACGCCAGTCCACATATTTTATAGCGATTATAGCGATGATGACCTATCCGCCG

Full Affymetrix probeset data:

Annotations for 1631781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720