FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631784_at:

>probe:Drosophila_2:1631784_at:13:155; Interrogation_Position=153; Antisense; ACAGGTACCTACTAAGTTCGAAGCT
>probe:Drosophila_2:1631784_at:570:377; Interrogation_Position=172; Antisense; GAAGCTATCTCGGAAAACTCACAAG
>probe:Drosophila_2:1631784_at:236:445; Interrogation_Position=196; Antisense; GATGAGGCTGTGACCTCCAGTGAAA
>probe:Drosophila_2:1631784_at:116:97; Interrogation_Position=250; Antisense; AGATCCACAGATCATCACCACAAGG
>probe:Drosophila_2:1631784_at:259:663; Interrogation_Position=287; Antisense; TAAAGTACACCCTCTGGACTGTCTA
>probe:Drosophila_2:1631784_at:102:587; Interrogation_Position=301; Antisense; TGGACTGTCTATCTGCTGTTCTGGA
>probe:Drosophila_2:1631784_at:542:333; Interrogation_Position=315; Antisense; GCTGTTCTGGATAACTCTCTACGTT
>probe:Drosophila_2:1631784_at:279:119; Interrogation_Position=32; Antisense; AGCTGCGACAGTATCGCGCTCAGAA
>probe:Drosophila_2:1631784_at:503:461; Interrogation_Position=362; Antisense; GATTGGTTTTCCTCATGTTTTCCGC
>probe:Drosophila_2:1631784_at:22:691; Interrogation_Position=391; Antisense; TTTGGCATCTACTTCAACACCCGAA
>probe:Drosophila_2:1631784_at:634:443; Interrogation_Position=438; Antisense; GATGAGTGCCTACAGCGTTTTCAAC
>probe:Drosophila_2:1631784_at:193:327; Interrogation_Position=470; Antisense; GCGAGAGTATAGACGGCACCTTGAA
>probe:Drosophila_2:1631784_at:31:131; Interrogation_Position=487; Antisense; ACCTTGAAGGCCGAGCAGTTCGAAA
>probe:Drosophila_2:1631784_at:614:79; Interrogation_Position=511; Antisense; AGGGAAATCCGCTATGGATCCGGAA

Paste this into a BLAST search page for me
ACAGGTACCTACTAAGTTCGAAGCTGAAGCTATCTCGGAAAACTCACAAGGATGAGGCTGTGACCTCCAGTGAAAAGATCCACAGATCATCACCACAAGGTAAAGTACACCCTCTGGACTGTCTATGGACTGTCTATCTGCTGTTCTGGAGCTGTTCTGGATAACTCTCTACGTTAGCTGCGACAGTATCGCGCTCAGAAGATTGGTTTTCCTCATGTTTTCCGCTTTGGCATCTACTTCAACACCCGAAGATGAGTGCCTACAGCGTTTTCAACGCGAGAGTATAGACGGCACCTTGAAACCTTGAAGGCCGAGCAGTTCGAAAAGGGAAATCCGCTATGGATCCGGAA

Full Affymetrix probeset data:

Annotations for 1631784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720