FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631785_at:

>probe:Drosophila_2:1631785_at:404:683; Interrogation_Position=2518; Antisense; TATCCGTCGAATCCATGGAGGCTGT
>probe:Drosophila_2:1631785_at:497:439; Interrogation_Position=2535; Antisense; GAGGCTGTGGAACTGCTCCTGACCA
>probe:Drosophila_2:1631785_at:254:65; Interrogation_Position=2559; Antisense; ATGGATCCCAATGAGCGACCGGCCG
>probe:Drosophila_2:1631785_at:278:167; Interrogation_Position=2599; Antisense; AAATGCGTCACTTTGCTTGCATCGA
>probe:Drosophila_2:1631785_at:617:723; Interrogation_Position=2611; Antisense; TTGCTTGCATCGACTGGGAGAATAT
>probe:Drosophila_2:1631785_at:349:457; Interrogation_Position=2682; Antisense; GATACGGGATATTTCGATGCGCGCA
>probe:Drosophila_2:1631785_at:556:637; Interrogation_Position=2695; Antisense; TCGATGCGCGCAACAATCTTCAGCA
>probe:Drosophila_2:1631785_at:549:263; Interrogation_Position=2724; Antisense; CAGCTGTCCAATTTTGCCCTAGAAG
>probe:Drosophila_2:1631785_at:173:111; Interrogation_Position=2747; Antisense; AGAATGATTGCCAAGCGGAGCCCGG
>probe:Drosophila_2:1631785_at:398:337; Interrogation_Position=2790; Antisense; GCTCGTACCGAGCACTGTATTATCG
>probe:Drosophila_2:1631785_at:92:431; Interrogation_Position=2845; Antisense; GAGTAGACCCTTAATGTTCATCTGT
>probe:Drosophila_2:1631785_at:545:39; Interrogation_Position=2864; Antisense; ATCTGTTATCGTTCGTGTAGCCCTA
>probe:Drosophila_2:1631785_at:177:515; Interrogation_Position=2878; Antisense; GTGTAGCCCTACGTATTTATATTTT
>probe:Drosophila_2:1631785_at:68:253; Interrogation_Position=3055; Antisense; CAAGTATGCACTTTCGAGACATGTA

Paste this into a BLAST search page for me
TATCCGTCGAATCCATGGAGGCTGTGAGGCTGTGGAACTGCTCCTGACCAATGGATCCCAATGAGCGACCGGCCGAAATGCGTCACTTTGCTTGCATCGATTGCTTGCATCGACTGGGAGAATATGATACGGGATATTTCGATGCGCGCATCGATGCGCGCAACAATCTTCAGCACAGCTGTCCAATTTTGCCCTAGAAGAGAATGATTGCCAAGCGGAGCCCGGGCTCGTACCGAGCACTGTATTATCGGAGTAGACCCTTAATGTTCATCTGTATCTGTTATCGTTCGTGTAGCCCTAGTGTAGCCCTACGTATTTATATTTTCAAGTATGCACTTTCGAGACATGTA

Full Affymetrix probeset data:

Annotations for 1631785_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720