FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631786_at:

>probe:Drosophila_2:1631786_at:230:107; Interrogation_Position=1902; Antisense; AGAAATCGTCGGTCAACTGCTTGGC
>probe:Drosophila_2:1631786_at:181:191; Interrogation_Position=1916; Antisense; AACTGCTTGGCCATCAACGAAACGG
>probe:Drosophila_2:1631786_at:265:631; Interrogation_Position=2033; Antisense; TCCTCCGTGATCAGTTGTGCGTACA
>probe:Drosophila_2:1631786_at:171:57; Interrogation_Position=2066; Antisense; ATGACCATGTTTGTCACCGGCAGCA
>probe:Drosophila_2:1631786_at:273:647; Interrogation_Position=2106; Antisense; TCATATGGGATGTGCCGCGTGACTT
>probe:Drosophila_2:1631786_at:97:317; Interrogation_Position=2149; Antisense; GCCGGATGTCACCAAGTATTCGCTA
>probe:Drosophila_2:1631786_at:510:481; Interrogation_Position=2164; Antisense; GTATTCGCTACCAAAGACATCGTCC
>probe:Drosophila_2:1631786_at:53:509; Interrogation_Position=2219; Antisense; GTGAACTCGGGCACCAATCTAAAGA
>probe:Drosophila_2:1631786_at:96:327; Interrogation_Position=2253; Antisense; GCGAGAACATCGATGGCCTGCTGAA
>probe:Drosophila_2:1631786_at:580:225; Interrogation_Position=2288; Antisense; AAGGACGATCTCTGCTGCGTGGAGT
>probe:Drosophila_2:1631786_at:582:519; Interrogation_Position=2345; Antisense; GTGGATCCCTATGCCGAGTGCGGAA
>probe:Drosophila_2:1631786_at:689:361; Interrogation_Position=2367; Antisense; GAATCGTTCCCGATGTCCGCAAGTG
>probe:Drosophila_2:1631786_at:377:85; Interrogation_Position=2388; Antisense; AGTGCTGAGATTTTCCTTTCCAATT
>probe:Drosophila_2:1631786_at:588:217; Interrogation_Position=2431; Antisense; AAGGCAGTTGTCCTTTCTAAGCTTG

Paste this into a BLAST search page for me
AGAAATCGTCGGTCAACTGCTTGGCAACTGCTTGGCCATCAACGAAACGGTCCTCCGTGATCAGTTGTGCGTACAATGACCATGTTTGTCACCGGCAGCATCATATGGGATGTGCCGCGTGACTTGCCGGATGTCACCAAGTATTCGCTAGTATTCGCTACCAAAGACATCGTCCGTGAACTCGGGCACCAATCTAAAGAGCGAGAACATCGATGGCCTGCTGAAAAGGACGATCTCTGCTGCGTGGAGTGTGGATCCCTATGCCGAGTGCGGAAGAATCGTTCCCGATGTCCGCAAGTGAGTGCTGAGATTTTCCTTTCCAATTAAGGCAGTTGTCCTTTCTAAGCTTG

Full Affymetrix probeset data:

Annotations for 1631786_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720