FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631790_at:

>probe:Drosophila_2:1631790_at:317:73; Interrogation_Position=1052; Antisense; AGGAAATCGCCAACCTACAGTCGAG
>probe:Drosophila_2:1631790_at:722:673; Interrogation_Position=1079; Antisense; TAGCGCGCTCCGAAACTCAAGTAAT
>probe:Drosophila_2:1631790_at:507:173; Interrogation_Position=1112; Antisense; AAAGCACCGCAGAAGCTGCCGAAAA
>probe:Drosophila_2:1631790_at:529:587; Interrogation_Position=1157; Antisense; TGGAGCGCCGCAAGCTGCAACGCGA
>probe:Drosophila_2:1631790_at:1:325; Interrogation_Position=1178; Antisense; GCGAGCACCGGGAACTCTTGGAGAA
>probe:Drosophila_2:1631790_at:509:377; Interrogation_Position=1210; Antisense; GAAGCTGAAACGTCCAACAACCATT
>probe:Drosophila_2:1631790_at:159:203; Interrogation_Position=1228; Antisense; AACCATTTGTTGAAACGCCTCGATA
>probe:Drosophila_2:1631790_at:229:433; Interrogation_Position=1269; Antisense; GAGTGCCATTCTAAAGGACTTATGA
>probe:Drosophila_2:1631790_at:602:591; Interrogation_Position=1301; Antisense; TGGGAAATGCAATCTCGCCAACCAT
>probe:Drosophila_2:1631790_at:586:251; Interrogation_Position=1319; Antisense; CAACCATTGAAGGATCGCACCCGAT
>probe:Drosophila_2:1631790_at:301:451; Interrogation_Position=1331; Antisense; GATCGCACCCGATGACATAGGAAAC
>probe:Drosophila_2:1631790_at:125:561; Interrogation_Position=1350; Antisense; GGAAACGCAAGTACACGACATCATC
>probe:Drosophila_2:1631790_at:493:25; Interrogation_Position=1404; Antisense; ATAGCACTTCGGTAGCAATTTAATC
>probe:Drosophila_2:1631790_at:27:657; Interrogation_Position=1424; Antisense; TAATCGGTCTTAGTGGTAGCAAATC

Paste this into a BLAST search page for me
AGGAAATCGCCAACCTACAGTCGAGTAGCGCGCTCCGAAACTCAAGTAATAAAGCACCGCAGAAGCTGCCGAAAATGGAGCGCCGCAAGCTGCAACGCGAGCGAGCACCGGGAACTCTTGGAGAAGAAGCTGAAACGTCCAACAACCATTAACCATTTGTTGAAACGCCTCGATAGAGTGCCATTCTAAAGGACTTATGATGGGAAATGCAATCTCGCCAACCATCAACCATTGAAGGATCGCACCCGATGATCGCACCCGATGACATAGGAAACGGAAACGCAAGTACACGACATCATCATAGCACTTCGGTAGCAATTTAATCTAATCGGTCTTAGTGGTAGCAAATC

Full Affymetrix probeset data:

Annotations for 1631790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720