Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631795_at:

>probe:Drosophila_2:1631795_at:435:647; Interrogation_Position=1088; Antisense; TCATGCAGCGATCATCTTCAGGACG
>probe:Drosophila_2:1631795_at:327:565; Interrogation_Position=1122; Antisense; GGCAAGTTCTTCGAATTCCTTACGC
>probe:Drosophila_2:1631795_at:700:309; Interrogation_Position=1166; Antisense; GCCAATTGACTACAGCGGACACAGA
>probe:Drosophila_2:1631795_at:156:225; Interrogation_Position=1190; Antisense; AAGGAATGTTCCTGCTCATGGCACT
>probe:Drosophila_2:1631795_at:562:67; Interrogation_Position=1207; Antisense; ATGGCACTGGGCTACTTTCTAGGAG
>probe:Drosophila_2:1631795_at:430:697; Interrogation_Position=1222; Antisense; TTTCTAGGAGCCACAGCCCTGGTAT
>probe:Drosophila_2:1631795_at:592:529; Interrogation_Position=1261; Antisense; GGGATTACCAACAAGTGCCGCCAAA
>probe:Drosophila_2:1631795_at:515:493; Interrogation_Position=1341; Antisense; GTCAATGCTTCGCACTAATGCCGAG
>probe:Drosophila_2:1631795_at:219:657; Interrogation_Position=1356; Antisense; TAATGCCGAGCAACTTTCCCATGAT
>probe:Drosophila_2:1631795_at:206:327; Interrogation_Position=1400; Antisense; GCGAGGCTGCTGAGGTTGCTCAAAA
>probe:Drosophila_2:1631795_at:301:369; Interrogation_Position=1436; Antisense; GAATGCGCGAGTTAAATCTTACCCG
>probe:Drosophila_2:1631795_at:725:647; Interrogation_Position=1509; Antisense; TCATGGTCAGCTAGACATCGTCCAC
>probe:Drosophila_2:1631795_at:136:43; Interrogation_Position=1525; Antisense; ATCGTCCACACTGAGTTTCCAAACA
>probe:Drosophila_2:1631795_at:135:379; Interrogation_Position=1591; Antisense; GAAGCTCTTGAATCTCTGCAGCGTT

Paste this into a BLAST search page for me
TCATGCAGCGATCATCTTCAGGACGGGCAAGTTCTTCGAATTCCTTACGCGCCAATTGACTACAGCGGACACAGAAAGGAATGTTCCTGCTCATGGCACTATGGCACTGGGCTACTTTCTAGGAGTTTCTAGGAGCCACAGCCCTGGTATGGGATTACCAACAAGTGCCGCCAAAGTCAATGCTTCGCACTAATGCCGAGTAATGCCGAGCAACTTTCCCATGATGCGAGGCTGCTGAGGTTGCTCAAAAGAATGCGCGAGTTAAATCTTACCCGTCATGGTCAGCTAGACATCGTCCACATCGTCCACACTGAGTTTCCAAACAGAAGCTCTTGAATCTCTGCAGCGTT

Full Affymetrix probeset data:

Annotations for 1631795_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime