FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631796_at:

>probe:Drosophila_2:1631796_at:30:359; Interrogation_Position=1246; Antisense; GCAAAGATGGCCACCGCGAGCAACA
>probe:Drosophila_2:1631796_at:472:263; Interrogation_Position=1342; Antisense; CAGACGGTTCTGGACGAGCTTTCAC
>probe:Drosophila_2:1631796_at:306:419; Interrogation_Position=1357; Antisense; GAGCTTTCACCAACCACCGATGAGT
>probe:Drosophila_2:1631796_at:370:89; Interrogation_Position=1379; Antisense; AGTACCAGGAGTTTGGCGATGCCAA
>probe:Drosophila_2:1631796_at:487:49; Interrogation_Position=1397; Antisense; ATGCCAAGGATGCAGTGGACGACTT
>probe:Drosophila_2:1631796_at:129:403; Interrogation_Position=1432; Antisense; GACATTGGCTATATACCTCCAGCAC
>probe:Drosophila_2:1631796_at:151:197; Interrogation_Position=1490; Antisense; AACTGGACGTGGACACCGTGGACGA
>probe:Drosophila_2:1631796_at:103:131; Interrogation_Position=1504; Antisense; ACCGTGGACGATGAGCCGTGCGAAC
>probe:Drosophila_2:1631796_at:175:285; Interrogation_Position=1582; Antisense; CTGGTGATGGCCTCCGGTTCGGTTA
>probe:Drosophila_2:1631796_at:440:251; Interrogation_Position=1671; Antisense; CAAGAAACTTAGCTCGCAGGACGAT
>probe:Drosophila_2:1631796_at:40:589; Interrogation_Position=1736; Antisense; TGGATGCAGCTGACCACAATGCGGT
>probe:Drosophila_2:1631796_at:175:161; Interrogation_Position=1751; Antisense; ACAATGCGGTGTGTCCCTGGGAAGA
>probe:Drosophila_2:1631796_at:126:417; Interrogation_Position=1777; Antisense; GAGAACGTCAGCACCAACGACGGCA
>probe:Drosophila_2:1631796_at:198:401; Interrogation_Position=1812; Antisense; GACATACGCCACACTGGGATACTTA

Paste this into a BLAST search page for me
GCAAAGATGGCCACCGCGAGCAACACAGACGGTTCTGGACGAGCTTTCACGAGCTTTCACCAACCACCGATGAGTAGTACCAGGAGTTTGGCGATGCCAAATGCCAAGGATGCAGTGGACGACTTGACATTGGCTATATACCTCCAGCACAACTGGACGTGGACACCGTGGACGAACCGTGGACGATGAGCCGTGCGAACCTGGTGATGGCCTCCGGTTCGGTTACAAGAAACTTAGCTCGCAGGACGATTGGATGCAGCTGACCACAATGCGGTACAATGCGGTGTGTCCCTGGGAAGAGAGAACGTCAGCACCAACGACGGCAGACATACGCCACACTGGGATACTTA

Full Affymetrix probeset data:

Annotations for 1631796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720