FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631800_at:

>probe:Drosophila_2:1631800_at:595:303; Interrogation_Position=1143; Antisense; CCGGGACGTAGTGGATGATCTGCAA
>probe:Drosophila_2:1631800_at:134:467; Interrogation_Position=1173; Antisense; GTTGGATCCCATCTTTGCGGAACAA
>probe:Drosophila_2:1631800_at:44:27; Interrogation_Position=1200; Antisense; ATACGTCGGTTGCTTGGGTTCTACA
>probe:Drosophila_2:1631800_at:611:29; Interrogation_Position=1229; Antisense; ATACTCGACGGTTTAGCTGCTCCTT
>probe:Drosophila_2:1631800_at:73:585; Interrogation_Position=1255; Antisense; TGGACACTGTTTCATTACTTCACCG
>probe:Drosophila_2:1631800_at:99:99; Interrogation_Position=1292; Antisense; AGATGAAGGTATATCCGCCCAGCTC
>probe:Drosophila_2:1631800_at:593:395; Interrogation_Position=1320; Antisense; GACAATTGGACTTTACGGACTTGCC
>probe:Drosophila_2:1631800_at:42:559; Interrogation_Position=1336; Antisense; GGACTTGCCAAGTTCTTTTACGACT
>probe:Drosophila_2:1631800_at:334:693; Interrogation_Position=1352; Antisense; TTTACGACTGCAAAGATGGTTCCAT
>probe:Drosophila_2:1631800_at:520:95; Interrogation_Position=1436; Antisense; AGATCCTATGGTTGTGGGAAGCCCA
>probe:Drosophila_2:1631800_at:416:181; Interrogation_Position=1476; Antisense; AAAACTAGCTGGAGACGCCTCTGGG
>probe:Drosophila_2:1631800_at:730:423; Interrogation_Position=1512; Antisense; TCCTAAAGTCCAGTTTCCGGAGCGG
>probe:Drosophila_2:1631800_at:609:719; Interrogation_Position=1542; Antisense; TTGCCCGGACTGCTATACACATTCA
>probe:Drosophila_2:1631800_at:471:121; Interrogation_Position=1630; Antisense; AGCGGCGATGCAGAACCACATTCAA

Paste this into a BLAST search page for me
CCGGGACGTAGTGGATGATCTGCAAGTTGGATCCCATCTTTGCGGAACAAATACGTCGGTTGCTTGGGTTCTACAATACTCGACGGTTTAGCTGCTCCTTTGGACACTGTTTCATTACTTCACCGAGATGAAGGTATATCCGCCCAGCTCGACAATTGGACTTTACGGACTTGCCGGACTTGCCAAGTTCTTTTACGACTTTTACGACTGCAAAGATGGTTCCATAGATCCTATGGTTGTGGGAAGCCCAAAAACTAGCTGGAGACGCCTCTGGGTCCTAAAGTCCAGTTTCCGGAGCGGTTGCCCGGACTGCTATACACATTCAAGCGGCGATGCAGAACCACATTCAA

Full Affymetrix probeset data:

Annotations for 1631800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720