FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631801_at:

>probe:Drosophila_2:1631801_at:436:233; Interrogation_Position=259; Antisense; AATCCGGACGCACAGCTGAACGAGA
>probe:Drosophila_2:1631801_at:50:361; Interrogation_Position=308; Antisense; GCAACGTGGTCTTCACCGCGGGAAA
>probe:Drosophila_2:1631801_at:32:43; Interrogation_Position=339; Antisense; ATCGGGTGACCGACTCATTGTGAAC
>probe:Drosophila_2:1631801_at:727:669; Interrogation_Position=367; Antisense; TACGATGACGACAGCTTTCCCAGTG
>probe:Drosophila_2:1631801_at:699:505; Interrogation_Position=406; Antisense; GTGCTCATGAGCTATCCGGCCGGAG
>probe:Drosophila_2:1631801_at:52:449; Interrogation_Position=487; Antisense; GATGCCGGTGGCTATCTGACCAAGG
>probe:Drosophila_2:1631801_at:309:309; Interrogation_Position=506; Antisense; CCAAGGGTGGCATCGGTCAGACCAA
>probe:Drosophila_2:1631801_at:158:39; Interrogation_Position=586; Antisense; ATCTATGGGTACTAGGACTGCTCGC
>probe:Drosophila_2:1631801_at:45:635; Interrogation_Position=607; Antisense; TCGCCCAGAACTTTCAGCTACAATA
>probe:Drosophila_2:1631801_at:280:663; Interrogation_Position=630; Antisense; TAAACGATTCGCTTGGAACCCAACT
>probe:Drosophila_2:1631801_at:106:597; Interrogation_Position=654; Antisense; TGTGATCATGAACTCCAGACCCTGC
>probe:Drosophila_2:1631801_at:563:321; Interrogation_Position=689; Antisense; GCCCTTCCTGCCGAGAGTATTATTA
>probe:Drosophila_2:1631801_at:532:697; Interrogation_Position=745; Antisense; TTTCAAACGGACTACTGTGCACATC
>probe:Drosophila_2:1631801_at:141:511; Interrogation_Position=761; Antisense; GTGCACATCCTTTTACTTATCCGTA

Paste this into a BLAST search page for me
AATCCGGACGCACAGCTGAACGAGAGCAACGTGGTCTTCACCGCGGGAAAATCGGGTGACCGACTCATTGTGAACTACGATGACGACAGCTTTCCCAGTGGTGCTCATGAGCTATCCGGCCGGAGGATGCCGGTGGCTATCTGACCAAGGCCAAGGGTGGCATCGGTCAGACCAAATCTATGGGTACTAGGACTGCTCGCTCGCCCAGAACTTTCAGCTACAATATAAACGATTCGCTTGGAACCCAACTTGTGATCATGAACTCCAGACCCTGCGCCCTTCCTGCCGAGAGTATTATTATTTCAAACGGACTACTGTGCACATCGTGCACATCCTTTTACTTATCCGTA

Full Affymetrix probeset data:

Annotations for 1631801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720