Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631803_at:

>probe:Drosophila_2:1631803_at:205:487; Interrogation_Position=1881; Antisense; GTACGGCAGGATGATCTCGCTGACG
>probe:Drosophila_2:1631803_at:125:407; Interrogation_Position=1902; Antisense; GACGGACAACCGCATGAACTTTATG
>probe:Drosophila_2:1631803_at:391:237; Interrogation_Position=1929; Antisense; AATCGATGAGTTCACCTATACCCTG
>probe:Drosophila_2:1631803_at:634:217; Interrogation_Position=1981; Antisense; AAGTCAACGGACTTCGCTTGGACCG
>probe:Drosophila_2:1631803_at:348:361; Interrogation_Position=2063; Antisense; GCAAGTATGATTACCCGCTGGACCT
>probe:Drosophila_2:1631803_at:682:267; Interrogation_Position=2169; Antisense; CATGGTGGTTCCATACATGGCGCCA
>probe:Drosophila_2:1631803_at:332:69; Interrogation_Position=2185; Antisense; ATGGCGCCACAGCACGAGCAGTTCT
>probe:Drosophila_2:1631803_at:135:691; Interrogation_Position=2215; Antisense; TTTGACTACACCTACTCGTGCGGCA
>probe:Drosophila_2:1631803_at:581:449; Interrogation_Position=2243; Antisense; GATCCGGAGCTCGACACGTGGACAG
>probe:Drosophila_2:1631803_at:397:585; Interrogation_Position=2261; Antisense; TGGACAGCCTGCCTTTTGGATATCC
>probe:Drosophila_2:1631803_at:710:637; Interrogation_Position=2300; Antisense; TCAACGAGTACGAGTTCCACGTGCC
>probe:Drosophila_2:1631803_at:365:547; Interrogation_Position=2340; Antisense; GGATGTGACCATCTATCATGCGGAT
>probe:Drosophila_2:1631803_at:88:193; Interrogation_Position=2401; Antisense; AACTACGGTCACTTCGATTACTCCT
>probe:Drosophila_2:1631803_at:181:13; Interrogation_Position=2417; Antisense; ATTACTCCTTCTTCAACGACTACTA

Paste this into a BLAST search page for me
GTACGGCAGGATGATCTCGCTGACGGACGGACAACCGCATGAACTTTATGAATCGATGAGTTCACCTATACCCTGAAGTCAACGGACTTCGCTTGGACCGGCAAGTATGATTACCCGCTGGACCTCATGGTGGTTCCATACATGGCGCCAATGGCGCCACAGCACGAGCAGTTCTTTTGACTACACCTACTCGTGCGGCAGATCCGGAGCTCGACACGTGGACAGTGGACAGCCTGCCTTTTGGATATCCTCAACGAGTACGAGTTCCACGTGCCGGATGTGACCATCTATCATGCGGATAACTACGGTCACTTCGATTACTCCTATTACTCCTTCTTCAACGACTACTA

Full Affymetrix probeset data:

Annotations for 1631803_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime