FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631805_at:

>probe:Drosophila_2:1631805_at:624:639; Interrogation_Position=1002; Antisense; TCTGCGCGAAAACGTTTTTACCAAG
>probe:Drosophila_2:1631805_at:124:283; Interrogation_Position=1041; Antisense; CTCCACTTTATCCACGGTTAACATG
>probe:Drosophila_2:1631805_at:306:661; Interrogation_Position=1059; Antisense; TAACATGTTCAAATGAGCGACCACT
>probe:Drosophila_2:1631805_at:62:57; Interrogation_Position=1071; Antisense; ATGAGCGACCACTTGGACGGGCAAT
>probe:Drosophila_2:1631805_at:138:409; Interrogation_Position=1086; Antisense; GACGGGCAATCGAACTTGAGCTCCA
>probe:Drosophila_2:1631805_at:76:725; Interrogation_Position=1101; Antisense; TTGAGCTCCAAGACCAAGAAATCTT
>probe:Drosophila_2:1631805_at:475:49; Interrogation_Position=653; Antisense; ATGCCCGCTACACCCTGTTGGACAA
>probe:Drosophila_2:1631805_at:127:605; Interrogation_Position=668; Antisense; TGTTGGACAACACTTTGCTGCGCCA
>probe:Drosophila_2:1631805_at:316:641; Interrogation_Position=747; Antisense; TCTGGGACTCCTAAGCAACGCTGGA
>probe:Drosophila_2:1631805_at:470:209; Interrogation_Position=759; Antisense; AAGCAACGCTGGACCCCAGTCCTGG
>probe:Drosophila_2:1631805_at:240:87; Interrogation_Position=776; Antisense; AGTCCTGGCATCCTGGTAGTCCGGA
>probe:Drosophila_2:1631805_at:141:591; Interrogation_Position=789; Antisense; TGGTAGTCCGGAACTCCTAGCTGTG
>probe:Drosophila_2:1631805_at:34:385; Interrogation_Position=799; Antisense; GAACTCCTAGCTGTGGGCAAACGGG
>probe:Drosophila_2:1631805_at:553:203; Interrogation_Position=841; Antisense; AAGAGGAACGTTGAGCTTGGAAAGC

Paste this into a BLAST search page for me
TCTGCGCGAAAACGTTTTTACCAAGCTCCACTTTATCCACGGTTAACATGTAACATGTTCAAATGAGCGACCACTATGAGCGACCACTTGGACGGGCAATGACGGGCAATCGAACTTGAGCTCCATTGAGCTCCAAGACCAAGAAATCTTATGCCCGCTACACCCTGTTGGACAATGTTGGACAACACTTTGCTGCGCCATCTGGGACTCCTAAGCAACGCTGGAAAGCAACGCTGGACCCCAGTCCTGGAGTCCTGGCATCCTGGTAGTCCGGATGGTAGTCCGGAACTCCTAGCTGTGGAACTCCTAGCTGTGGGCAAACGGGAAGAGGAACGTTGAGCTTGGAAAGC

Full Affymetrix probeset data:

Annotations for 1631805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720