Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631806_at:

>probe:Drosophila_2:1631806_at:495:269; Interrogation_Position=1203; Antisense; CATGCTCGACGGATATGTGTCCTGG
>probe:Drosophila_2:1631806_at:158:359; Interrogation_Position=1253; Antisense; GCAACGGCTACGAGGCAAACTACAT
>probe:Drosophila_2:1631806_at:696:177; Interrogation_Position=1269; Antisense; AAACTACATGGATAACTCCCGCGAC
>probe:Drosophila_2:1631806_at:381:439; Interrogation_Position=1329; Antisense; GATGGCTGGATTCACCACTGGCAAC
>probe:Drosophila_2:1631806_at:301:539; Interrogation_Position=1368; Antisense; GGTATCCACGGATTATCGCCAGAGG
>probe:Drosophila_2:1631806_at:580:415; Interrogation_Position=1422; Antisense; GAGCCACCTGAACGTGTTCAAGCGT
>probe:Drosophila_2:1631806_at:107:305; Interrogation_Position=1458; Antisense; CCGTCAGGAGCCCAGCATTGAAGAA
>probe:Drosophila_2:1631806_at:559:449; Interrogation_Position=1484; Antisense; GATCCGCCGAGGTCAAGGCTGTTAG
>probe:Drosophila_2:1631806_at:24:63; Interrogation_Position=1499; Antisense; AGGCTGTTAGCAACTACGTCCTGGC
>probe:Drosophila_2:1631806_at:381:635; Interrogation_Position=1586; Antisense; TCGAGAATGTGAACCTATCCAGTGT
>probe:Drosophila_2:1631806_at:640:683; Interrogation_Position=1601; Antisense; TATCCAGTGTGTTTGGCAGCCTGCC
>probe:Drosophila_2:1631806_at:629:303; Interrogation_Position=1644; Antisense; CCTGGTCACCGAGAAGTCCATCAAG
>probe:Drosophila_2:1631806_at:255:433; Interrogation_Position=1717; Antisense; GAGTCCATTGTGCTGCGTTCCACAA
>probe:Drosophila_2:1631806_at:381:185; Interrogation_Position=1743; Antisense; AACAGCTTAGTTTATTCCCCTCGTG

Paste this into a BLAST search page for me
CATGCTCGACGGATATGTGTCCTGGGCAACGGCTACGAGGCAAACTACATAAACTACATGGATAACTCCCGCGACGATGGCTGGATTCACCACTGGCAACGGTATCCACGGATTATCGCCAGAGGGAGCCACCTGAACGTGTTCAAGCGTCCGTCAGGAGCCCAGCATTGAAGAAGATCCGCCGAGGTCAAGGCTGTTAGAGGCTGTTAGCAACTACGTCCTGGCTCGAGAATGTGAACCTATCCAGTGTTATCCAGTGTGTTTGGCAGCCTGCCCCTGGTCACCGAGAAGTCCATCAAGGAGTCCATTGTGCTGCGTTCCACAAAACAGCTTAGTTTATTCCCCTCGTG

Full Affymetrix probeset data:

Annotations for 1631806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime