FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631807_at:

>probe:Drosophila_2:1631807_at:122:449; Interrogation_Position=1165; Antisense; GATGCCAAAATTAAGCTGCGCGAGA
>probe:Drosophila_2:1631807_at:63:651; Interrogation_Position=1259; Antisense; TCAAACTGATTCTGGACTCTAACGA
>probe:Drosophila_2:1631807_at:315:95; Interrogation_Position=1284; Antisense; AGATAAATGGTCTGGTCGTCTGCCC
>probe:Drosophila_2:1631807_at:433:499; Interrogation_Position=1301; Antisense; GTCTGCCCATGAGAGAGATTGCCCA
>probe:Drosophila_2:1631807_at:725:721; Interrogation_Position=1319; Antisense; TTGCCCAGGCTCTCACCAAGGAGGA
>probe:Drosophila_2:1631807_at:15:13; Interrogation_Position=1354; Antisense; ATTAAATCCGAGTGCGGCGGCATCA
>probe:Drosophila_2:1631807_at:381:573; Interrogation_Position=1369; Antisense; GGCGGCATCAAAACATTGCTGCGCA
>probe:Drosophila_2:1631807_at:522:297; Interrogation_Position=1410; Antisense; CGAATTCTGCGGTGGTGATCTCATA
>probe:Drosophila_2:1631807_at:662:389; Interrogation_Position=1491; Antisense; GAAACGTAGCTGCTTTTTCAAGCTT
>probe:Drosophila_2:1631807_at:459:697; Interrogation_Position=1506; Antisense; TTTCAAGCTTCATCATCCGCTGGGA
>probe:Drosophila_2:1631807_at:520:593; Interrogation_Position=1526; Antisense; TGGGATGTCCTCTCGATGATGCTGA
>probe:Drosophila_2:1631807_at:135:447; Interrogation_Position=1543; Antisense; GATGCTGAGTGCTCGTTTATACACT
>probe:Drosophila_2:1631807_at:119:207; Interrogation_Position=1568; Antisense; AAGCTAACTCTCTATGTGTGTGGTA
>probe:Drosophila_2:1631807_at:452:517; Interrogation_Position=1583; Antisense; GTGTGTGGTATTTGCTCACCTTTAT

Paste this into a BLAST search page for me
GATGCCAAAATTAAGCTGCGCGAGATCAAACTGATTCTGGACTCTAACGAAGATAAATGGTCTGGTCGTCTGCCCGTCTGCCCATGAGAGAGATTGCCCATTGCCCAGGCTCTCACCAAGGAGGAATTAAATCCGAGTGCGGCGGCATCAGGCGGCATCAAAACATTGCTGCGCACGAATTCTGCGGTGGTGATCTCATAGAAACGTAGCTGCTTTTTCAAGCTTTTTCAAGCTTCATCATCCGCTGGGATGGGATGTCCTCTCGATGATGCTGAGATGCTGAGTGCTCGTTTATACACTAAGCTAACTCTCTATGTGTGTGGTAGTGTGTGGTATTTGCTCACCTTTAT

Full Affymetrix probeset data:

Annotations for 1631807_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720