Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631812_at:

>probe:Drosophila_2:1631812_at:346:171; Interrogation_Position=1016; Antisense; AAAGTGGCACTTAACCCATCATAAG
>probe:Drosophila_2:1631812_at:214:205; Interrogation_Position=1058; Antisense; AAGCTCTTAGCCGTAATAACACAAG
>probe:Drosophila_2:1631812_at:340:287; Interrogation_Position=503; Antisense; CTGGTACACTTATCGACTTTGAAAA
>probe:Drosophila_2:1631812_at:707:415; Interrogation_Position=637; Antisense; GAGCCGGCAAACGAGCTTGATTCTA
>probe:Drosophila_2:1631812_at:225:663; Interrogation_Position=660; Antisense; TAAACTGGAGGTTCTGATTCCCGAA
>probe:Drosophila_2:1631812_at:640:603; Interrogation_Position=674; Antisense; TGATTCCCGAAATCCCTGAGCTACA
>probe:Drosophila_2:1631812_at:214:609; Interrogation_Position=690; Antisense; TGAGCTACACTTGGGCACAGCAGAT
>probe:Drosophila_2:1631812_at:129:567; Interrogation_Position=703; Antisense; GGCACAGCAGATGATCCCATAAACT
>probe:Drosophila_2:1631812_at:300:663; Interrogation_Position=722; Antisense; TAAACTCTGATTGCGATTCTCTTCG
>probe:Drosophila_2:1631812_at:446:463; Interrogation_Position=736; Antisense; GATTCTCTTCGCACTGCTTATGATT
>probe:Drosophila_2:1631812_at:183:275; Interrogation_Position=752; Antisense; CTTATGATTTTCCACCAGGTCACGA
>probe:Drosophila_2:1631812_at:470:79; Interrogation_Position=768; Antisense; AGGTCACGATGATCGCGCGAACGAA
>probe:Drosophila_2:1631812_at:728:527; Interrogation_Position=916; Antisense; GGGACTCTTAACGACACCATATGGA
>probe:Drosophila_2:1631812_at:142:315; Interrogation_Position=964; Antisense; GCCAGTGTTTAAACATCCTCATCTT

Paste this into a BLAST search page for me
AAAGTGGCACTTAACCCATCATAAGAAGCTCTTAGCCGTAATAACACAAGCTGGTACACTTATCGACTTTGAAAAGAGCCGGCAAACGAGCTTGATTCTATAAACTGGAGGTTCTGATTCCCGAATGATTCCCGAAATCCCTGAGCTACATGAGCTACACTTGGGCACAGCAGATGGCACAGCAGATGATCCCATAAACTTAAACTCTGATTGCGATTCTCTTCGGATTCTCTTCGCACTGCTTATGATTCTTATGATTTTCCACCAGGTCACGAAGGTCACGATGATCGCGCGAACGAAGGGACTCTTAACGACACCATATGGAGCCAGTGTTTAAACATCCTCATCTT

Full Affymetrix probeset data:

Annotations for 1631812_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime