FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631813_at:

>probe:Drosophila_2:1631813_at:179:109; Interrogation_Position=250; Antisense; AGAAGATGCACTATGGCGATACCCA
>probe:Drosophila_2:1631813_at:237:583; Interrogation_Position=263; Antisense; TGGCGATACCCATCTGCAGAGGAGA
>probe:Drosophila_2:1631813_at:338:517; Interrogation_Position=292; Antisense; GTGTGCGGAATCGACGTCGTGATCT
>probe:Drosophila_2:1631813_at:481:43; Interrogation_Position=324; Antisense; ATCGACGACGATCTGCAGACCCGGA
>probe:Drosophila_2:1631813_at:186:411; Interrogation_Position=341; Antisense; GACCCGGAGCGGTGAACTGATCAAT
>probe:Drosophila_2:1631813_at:51:231; Interrogation_Position=369; Antisense; AATGTGGATCTCGACAAGCCGGGAT
>probe:Drosophila_2:1631813_at:227:161; Interrogation_Position=382; Antisense; ACAAGCCGGGATTCGCGCAGTTCTA
>probe:Drosophila_2:1631813_at:554:93; Interrogation_Position=400; Antisense; AGTTCTACTGCGTGCACTGTGCCAA
>probe:Drosophila_2:1631813_at:326:213; Interrogation_Position=477; Antisense; AAGAGGCGTCTCAAGGCCCTAGAGA
>probe:Drosophila_2:1631813_at:419:321; Interrogation_Position=492; Antisense; GCCCTAGAGATCGAGCCGTACAGCA
>probe:Drosophila_2:1631813_at:700:407; Interrogation_Position=541; Antisense; GACGTGGCAGCTTCGTGAAGCCCAA
>probe:Drosophila_2:1631813_at:461:435; Interrogation_Position=642; Antisense; GAGGATACAGATGCCACCGATTCGC
>probe:Drosophila_2:1631813_at:653:461; Interrogation_Position=660; Antisense; GATTCGCCATCGACGTCCAAAACGA
>probe:Drosophila_2:1631813_at:285:107; Interrogation_Position=798; Antisense; AGAACTCTGTTTACCTCCAATTGCT

Paste this into a BLAST search page for me
AGAAGATGCACTATGGCGATACCCATGGCGATACCCATCTGCAGAGGAGAGTGTGCGGAATCGACGTCGTGATCTATCGACGACGATCTGCAGACCCGGAGACCCGGAGCGGTGAACTGATCAATAATGTGGATCTCGACAAGCCGGGATACAAGCCGGGATTCGCGCAGTTCTAAGTTCTACTGCGTGCACTGTGCCAAAAGAGGCGTCTCAAGGCCCTAGAGAGCCCTAGAGATCGAGCCGTACAGCAGACGTGGCAGCTTCGTGAAGCCCAAGAGGATACAGATGCCACCGATTCGCGATTCGCCATCGACGTCCAAAACGAAGAACTCTGTTTACCTCCAATTGCT

Full Affymetrix probeset data:

Annotations for 1631813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720