FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631816_at:

>probe:Drosophila_2:1631816_at:27:331; Interrogation_Position=119; Antisense; GCGGAGCTGGTCCTGGAACCTTTTT
>probe:Drosophila_2:1631816_at:492:591; Interrogation_Position=126; Antisense; TGGTCCTGGAACCTTTTTCGAGACA
>probe:Drosophila_2:1631816_at:309:277; Interrogation_Position=138; Antisense; CTTTTTCGAGACACAGCAGGGCAAC
>probe:Drosophila_2:1631816_at:377:111; Interrogation_Position=152; Antisense; AGCAGGGCAACTGCAAGACCTCCAA
>probe:Drosophila_2:1631816_at:501:359; Interrogation_Position=164; Antisense; GCAAGACCTCCAACGAAATGCTGCT
>probe:Drosophila_2:1631816_at:481:167; Interrogation_Position=179; Antisense; AAATGCTGCTCGAGATCTTCCGCTT
>probe:Drosophila_2:1631816_at:281:37; Interrogation_Position=193; Antisense; ATCTTCCGCTTCGTGCAATCTCAGG
>probe:Drosophila_2:1631816_at:714:237; Interrogation_Position=209; Antisense; AATCTCAGGCACAGCTCTTTCTGGA
>probe:Drosophila_2:1631816_at:574:117; Interrogation_Position=221; Antisense; AGCTCTTTCTGGACTGCAAGCACCG
>probe:Drosophila_2:1631816_at:137:103; Interrogation_Position=23; Antisense; AGAGCGAAGTCCTCATTGCAGCCGT
>probe:Drosophila_2:1631816_at:517:645; Interrogation_Position=35; Antisense; TCATTGCAGCCGTGCTCTTCATGCT
>probe:Drosophila_2:1631816_at:632:619; Interrogation_Position=47; Antisense; TGCTCTTCATGCTGCTGGCCTGCGT
>probe:Drosophila_2:1631816_at:190:581; Interrogation_Position=62; Antisense; TGGCCTGCGTCCAGTGTCAATTGAC
>probe:Drosophila_2:1631816_at:471:599; Interrogation_Position=78; Antisense; TCAATTGACCTTCTCGCCGGATTGG

Paste this into a BLAST search page for me
GCGGAGCTGGTCCTGGAACCTTTTTTGGTCCTGGAACCTTTTTCGAGACACTTTTTCGAGACACAGCAGGGCAACAGCAGGGCAACTGCAAGACCTCCAAGCAAGACCTCCAACGAAATGCTGCTAAATGCTGCTCGAGATCTTCCGCTTATCTTCCGCTTCGTGCAATCTCAGGAATCTCAGGCACAGCTCTTTCTGGAAGCTCTTTCTGGACTGCAAGCACCGAGAGCGAAGTCCTCATTGCAGCCGTTCATTGCAGCCGTGCTCTTCATGCTTGCTCTTCATGCTGCTGGCCTGCGTTGGCCTGCGTCCAGTGTCAATTGACTCAATTGACCTTCTCGCCGGATTGG

Full Affymetrix probeset data:

Annotations for 1631816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720